Incidental Mutation 'R8858:Tmprss15'
ID675488
Institutional Source Beutler Lab
Gene Symbol Tmprss15
Ensembl Gene ENSMUSG00000022857
Gene Nametransmembrane protease, serine 15
SynonymsA130097D21Rik, enterokinase, enteropeptidase, Prss7
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8858 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location78953008-79091097 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 79057609 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023566] [ENSMUST00000060402]
Predicted Effect probably null
Transcript: ENSMUST00000023566
SMART Domains Protein: ENSMUSP00000023566
Gene: ENSMUSG00000022857

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 228 268 1.74e-4 SMART
CUB 270 379 1.54e-11 SMART
MAM 387 549 7.33e-54 SMART
low complexity region 551 567 N/A INTRINSIC
CUB 569 679 1.72e-32 SMART
LDLa 687 724 7.32e-12 SMART
SR 723 813 3.12e-5 SMART
Tryp_SPc 829 1064 1.48e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060402
SMART Domains Protein: ENSMUSP00000052034
Gene: ENSMUSG00000022857

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 213 253 1.74e-4 SMART
CUB 255 364 1.54e-11 SMART
MAM 372 534 7.33e-54 SMART
low complexity region 536 552 N/A INTRINSIC
CUB 554 664 1.72e-32 SMART
LDLa 672 709 7.32e-12 SMART
SR 708 798 3.12e-5 SMART
Tryp_SPc 814 1049 1.48e-95 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that proteolytically activates the pancreatic proenzyme trypsinogen, converting it into trypsin. The encoded protein is cleaved into two chains that form a heterodimer linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik A G 5: 138,640,076 Q91R probably benign Het
Abca16 G T 7: 120,453,104 C465F probably benign Het
Amfr A G 8: 93,987,442 Y254H probably damaging Het
Arl6ip6 A G 2: 53,203,006 E181G probably damaging Het
Atp10a A G 7: 58,816,223 E1066G probably damaging Het
BC034090 A G 1: 155,226,218 V100A probably benign Het
Cep126 T C 9: 8,130,269 M54V probably benign Het
Csmd1 A G 8: 16,070,304 V1829A probably benign Het
Cyp2c54 G A 19: 40,073,783 T10I probably benign Het
Disc1 A G 8: 125,251,042 Y799C probably damaging Het
Dnajc17 T C 2: 119,180,964 T162A probably benign Het
E330009J07Rik T C 6: 40,422,735 N173S probably benign Het
Fam96a T C 9: 66,132,542 I47T probably damaging Het
Fhad1 T C 4: 141,939,028 E695G possibly damaging Het
Gadl1 A T 9: 116,006,601 S366C probably damaging Het
Gm32742 T A 9: 51,150,956 T691S probably benign Het
Gm8765 T C 13: 50,701,387 S354P probably benign Het
Gsdma3 C A 11: 98,629,869 Q109K probably benign Het
Hsph1 A T 5: 149,625,111 V482E probably damaging Het
Ighv1-23 T A 12: 114,764,463 Y113F probably benign Het
Lactb G T 9: 66,955,900 Y477* probably null Het
Lgr6 T C 1: 134,996,111 probably null Het
Map3k4 A C 17: 12,271,872 L224R probably damaging Het
Mex3d A T 10: 80,381,383 C667S unknown Het
Myh8 A G 11: 67,301,994 E1537G possibly damaging Het
Myo5a T C 9: 75,184,683 S1205P probably damaging Het
Olfr1278 G A 2: 111,293,158 V297M probably benign Het
Olfr171 A G 16: 19,624,359 V247A probably damaging Het
Orc2 A T 1: 58,493,698 D127E probably benign Het
Ppp2r5c T A 12: 110,552,895 probably null Het
Ptpn18 A G 1: 34,463,115 T71A possibly damaging Het
Ralgapa2 C A 2: 146,260,365 probably null Het
Rnase9 G A 14: 51,039,309 P71S Het
Ryr1 A G 7: 29,109,213 L485P probably benign Het
Sardh T C 2: 27,228,290 D476G probably null Het
Sorbs3 T C 14: 70,201,401 Y170C probably damaging Het
St8sia5 C T 18: 77,232,815 P88S probably benign Het
Tnfrsf13b A G 11: 61,147,537 I215M possibly damaging Het
Unc13d G T 11: 116,062,792 L1052M probably damaging Het
Vasn A G 16: 4,648,969 D260G probably benign Het
Wdr77 T C 3: 105,961,662 V116A probably damaging Het
Zfp560 A G 9: 20,349,107 I153T probably benign Het
Zfp672 G A 11: 58,317,319 R59C possibly damaging Het
Other mutations in Tmprss15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Tmprss15 APN 16 78985994 missense possibly damaging 0.87
IGL00477:Tmprss15 APN 16 79021413 missense probably damaging 1.00
IGL01583:Tmprss15 APN 16 79071261 missense probably benign
IGL01896:Tmprss15 APN 16 79090790 missense probably benign 0.22
IGL02052:Tmprss15 APN 16 79087506 missense probably damaging 1.00
IGL02374:Tmprss15 APN 16 79035168 missense probably benign 0.00
IGL02505:Tmprss15 APN 16 78987741 missense probably benign 0.00
IGL02632:Tmprss15 APN 16 78985902 missense probably damaging 0.98
IGL02674:Tmprss15 APN 16 79001794 missense possibly damaging 0.72
PIT1430001:Tmprss15 UTSW 16 79024752 critical splice donor site probably null
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0195:Tmprss15 UTSW 16 79034334 missense probably benign 0.05
R0335:Tmprss15 UTSW 16 79024742 splice site probably benign
R0514:Tmprss15 UTSW 16 78968267 missense probably benign 0.05
R0552:Tmprss15 UTSW 16 79024749 splice site probably null
R0675:Tmprss15 UTSW 16 78985950 missense probably damaging 0.98
R0739:Tmprss15 UTSW 16 79024848 missense possibly damaging 0.62
R1435:Tmprss15 UTSW 16 79021454 missense probably benign 0.03
R1446:Tmprss15 UTSW 16 79078958 missense probably benign 0.01
R1572:Tmprss15 UTSW 16 79090829 missense probably benign 0.00
R1708:Tmprss15 UTSW 16 79054070 missense possibly damaging 0.95
R1893:Tmprss15 UTSW 16 79071418 missense probably benign
R2403:Tmprss15 UTSW 16 79057690 missense probably damaging 1.00
R2866:Tmprss15 UTSW 16 79035233 missense possibly damaging 0.65
R2913:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R2914:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R3425:Tmprss15 UTSW 16 79003433 missense possibly damaging 0.83
R3703:Tmprss15 UTSW 16 79054142 critical splice acceptor site probably null
R3916:Tmprss15 UTSW 16 78985996 missense probably damaging 1.00
R3950:Tmprss15 UTSW 16 79073186 missense probably benign 0.04
R4332:Tmprss15 UTSW 16 79034334 missense probably benign 0.15
R4392:Tmprss15 UTSW 16 79024438 missense probably damaging 1.00
R4515:Tmprss15 UTSW 16 78957356 missense probably benign 0.00
R4619:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4620:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4754:Tmprss15 UTSW 16 79054124 missense probably damaging 0.98
R4853:Tmprss15 UTSW 16 78960591 missense probably benign
R5159:Tmprss15 UTSW 16 79003410 missense probably benign 0.26
R5441:Tmprss15 UTSW 16 79071447 critical splice acceptor site probably null
R5824:Tmprss15 UTSW 16 79034313 missense probably damaging 0.99
R5970:Tmprss15 UTSW 16 79057659 missense probably benign 0.00
R6224:Tmprss15 UTSW 16 79024378 missense probably benign 0.08
R6257:Tmprss15 UTSW 16 78972225 missense probably damaging 1.00
R6313:Tmprss15 UTSW 16 78962170 missense probably benign 0.16
R6368:Tmprss15 UTSW 16 79006057 splice site probably null
R6525:Tmprss15 UTSW 16 79003378 missense probably damaging 0.97
R6587:Tmprss15 UTSW 16 79071429 missense probably benign
R6894:Tmprss15 UTSW 16 79075814 nonsense probably null
R7018:Tmprss15 UTSW 16 79024853 missense possibly damaging 0.78
R7180:Tmprss15 UTSW 16 78967998 missense probably damaging 0.97
R7324:Tmprss15 UTSW 16 78962019 missense probably damaging 1.00
R7337:Tmprss15 UTSW 16 79071276 missense probably benign 0.01
R7558:Tmprss15 UTSW 16 79003414 missense possibly damaging 0.55
R7732:Tmprss15 UTSW 16 79003420 missense probably benign 0.11
R7792:Tmprss15 UTSW 16 79003387 missense probably damaging 1.00
R7829:Tmprss15 UTSW 16 78987650 missense probably benign 0.02
R7998:Tmprss15 UTSW 16 79001843 missense possibly damaging 0.79
R8009:Tmprss15 UTSW 16 79090863 missense probably damaging 0.96
R8145:Tmprss15 UTSW 16 78960585 missense probably damaging 1.00
R8183:Tmprss15 UTSW 16 79087512 missense probably benign 0.04
R8221:Tmprss15 UTSW 16 79024335 missense probably damaging 0.99
R8294:Tmprss15 UTSW 16 79071288 missense probably benign
R8537:Tmprss15 UTSW 16 79087515 missense probably damaging 0.99
R8735:Tmprss15 UTSW 16 79001814 missense possibly damaging 0.88
R8869:Tmprss15 UTSW 16 78953946 nonsense probably null
R8884:Tmprss15 UTSW 16 79024769 missense probably benign 0.00
RF005:Tmprss15 UTSW 16 78953801 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACACATAGCTTTTCTTGGTACAGAG -3'
(R):5'- ATTGTCACGGGGAAATGCAG -3'

Sequencing Primer
(F):5'- TTCTTGGTACAGAGTAGTTTTTAAGG -3'
(R):5'- CCTCTAGAAAAAGAAGGCCTGCTG -3'
Posted On2021-07-15