Mutagenetix > Incidental Mutation

Incidental Mutation 'R0731:Dctn1'

67549

Institutional Source

Beutler Lab

Gene Symbol

Dctn1

Ensembl Gene

ENSMUSG00000031865

Gene Name

dynactin 1

Synonyms

p150, Glued, p150

MMRRC Submission

038912-MU

Accession Numbers

Ncbi RefSeq: NM_007835.2, NM_001198866.1, NM_001198867.1; MGI: 107745

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0731 (G1)

Quality Score

160

Status

Validated

Chromosome

Chromosomal Location

83165920-83200117 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83183089 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 87 (T87A)

Ref Sequence

ENSEMBL: ENSMUSP00000076623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077407] [ENSMUST00000113907] [ENSMUST00000113913] [ENSMUST00000113918] [ENSMUST00000113919] [ENSMUST00000130212] [ENSMUST00000141680]

AlphaFold

O08788

Predicted Effect

probably damaging
Transcript: ENSMUST00000077407
AA Change: T87A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865
AA Change: T87A

Domain	Start	End	E-Value	Type
CAP_GLY	12	78	5.52e-31	SMART
low complexity region	124	147	N/A	INTRINSIC
low complexity region	148	177	N/A	INTRINSIC
SCOP:d1fxkc_	185	337	3e-3	SMART
low complexity region	363	379	N/A	INTRINSIC
Pfam:Dynactin	489	768	8.2e-91	PFAM
low complexity region	800	820	N/A	INTRINSIC
coiled coil region	914	1009	N/A	INTRINSIC
low complexity region	1025	1043	N/A	INTRINSIC
coiled coil region	1143	1172	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113907

SMART Domains

Protein: ENSMUSP00000109540
Gene: ENSMUSG00000031865

Domain	Start	End	E-Value	Type
low complexity region	5	22	N/A	INTRINSIC
low complexity region	27	50	N/A	INTRINSIC
low complexity region	51	80	N/A	INTRINSIC
low complexity region	93	106	N/A	INTRINSIC
low complexity region	140	158	N/A	INTRINSIC
SCOP:d1lxa__	271	345	8e-3	SMART
Pfam:Dynactin	392	671	7.1e-91	PFAM
low complexity region	703	723	N/A	INTRINSIC
coiled coil region	817	912	N/A	INTRINSIC
low complexity region	928	946	N/A	INTRINSIC
coiled coil region	1046	1075	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113913
AA Change: T87A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865
AA Change: T87A

Domain	Start	End	E-Value	Type
CAP_GLY	12	78	5.52e-31	SMART
low complexity region	118	139	N/A	INTRINSIC
low complexity region	144	167	N/A	INTRINSIC
low complexity region	168	197	N/A	INTRINSIC
SCOP:d1fxkc_	205	357	3e-3	SMART
low complexity region	383	399	N/A	INTRINSIC
Pfam:Dynactin	509	788	2.5e-90	PFAM
low complexity region	820	840	N/A	INTRINSIC
coiled coil region	934	1029	N/A	INTRINSIC
low complexity region	1051	1069	N/A	INTRINSIC
coiled coil region	1168	1197	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113918
AA Change: T104A

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000109551
Gene: ENSMUSG00000031865
AA Change: T104A

Domain	Start	End	E-Value	Type
CAP_GLY	29	95	5.52e-31	SMART
low complexity region	135	156	N/A	INTRINSIC
low complexity region	161	184	N/A	INTRINSIC
low complexity region	185	214	N/A	INTRINSIC
low complexity region	227	240	N/A	INTRINSIC
low complexity region	274	292	N/A	INTRINSIC
low complexity region	400	416	N/A	INTRINSIC
Pfam:Dynactin	526	805	3.3e-90	PFAM
low complexity region	837	857	N/A	INTRINSIC
coiled coil region	951	1046	N/A	INTRINSIC
coiled coil region	1147	1176	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113919
AA Change: T104A

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000109552
Gene: ENSMUSG00000031865
AA Change: T104A

Domain	Start	End	E-Value	Type
CAP_GLY	29	95	5.52e-31	SMART
low complexity region	135	156	N/A	INTRINSIC
low complexity region	161	184	N/A	INTRINSIC
low complexity region	185	214	N/A	INTRINSIC
SCOP:d1fxkc_	222	374	3e-3	SMART
low complexity region	400	416	N/A	INTRINSIC
Pfam:Dynactin	522	805	1.4e-103	PFAM
low complexity region	837	857	N/A	INTRINSIC
coiled coil region	951	1046	N/A	INTRINSIC
low complexity region	1068	1086	N/A	INTRINSIC
coiled coil region	1185	1214	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130212
AA Change: T87A

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000115838
Gene: ENSMUSG00000031865
AA Change: T87A

Domain	Start	End	E-Value	Type
CAP_GLY	12	78	5.52e-31	SMART
low complexity region	124	147	N/A	INTRINSIC
low complexity region	148	177	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141680
AA Change: T87A

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000121538
Gene: ENSMUSG00000031865
AA Change: T87A

Domain	Start	End	E-Value	Type
CAP_GLY	12	78	5.52e-31	SMART
low complexity region	118	139	N/A	INTRINSIC
low complexity region	144	159	N/A	INTRINSIC

Meta Mutation Damage Score

0.0811

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

Strain: 3769512
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. Dynactin is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit interacts with dynein intermediate chain by its domains directly binding to dynein and binds to microtubules via a highly conserved glycine-rich cytoskeleton-associated protein (CAP-Gly) domain in its N-terminus. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause distal hereditary motor neuronopathy type VIIB (HMN7B) which is also known as distal spinal and bulbar muscular atrophy (dSBMA). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and developmental arrest at E7.5 associated with increased apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(20) : Targeted(4) Gene trapped(16)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430F08Rik	T	C	10: 100,586,203	T66A	probably damaging	Het
4933406M09Rik	A	C	1: 134,389,975	M162L	probably benign	Het
Acsm3	A	T	7: 119,768,024	R27*	probably null	Het
Actg1	A	G	11: 120,346,949	F255S	probably damaging	Het
Ahdc1	T	A	4: 133,062,951	V501E	possibly damaging	Het
Alpk2	A	T	18: 65,305,390	D1444E	probably damaging	Het
Btaf1	T	G	19: 36,997,495		probably null	Het
Cacnb2	A	G	2: 14,985,706	H489R	possibly damaging	Het
Ccdc162	C	A	10: 41,579,143	K398N	probably damaging	Het
Cd79b	G	T	11: 106,312,433	S145R	probably damaging	Het
Cdh11	T	A	8: 102,668,019	N264Y	probably damaging	Het
Celsr1	T	C	15: 85,901,597	D2892G	probably benign	Het
Chuk	A	G	19: 44,103,766		probably benign	Het
Clk3	T	C	9: 57,751,126		probably benign	Het
Dcaf8	A	T	1: 172,172,509	D78V	possibly damaging	Het
Ddx50	T	C	10: 62,616,249	N732D	unknown	Het
Dnah5	A	T	15: 28,311,143	Y1756F	possibly damaging	Het
Dock3	A	T	9: 106,969,856	V858E	probably damaging	Het
Fer1l4	A	G	2: 156,024,070	F1566S	probably benign	Het
Fpr-rs7	T	C	17: 20,113,854	I125V	probably benign	Het
Fuca2	C	T	10: 13,506,027	P228L	probably benign	Het
Galntl6	A	G	8: 58,535,984	F57L	probably benign	Het
Gigyf2	T	A	1: 87,407,727		probably benign	Het
Gm16505	A	T	13: 3,361,329		noncoding transcript	Het
Gm4781	T	C	10: 100,396,777		noncoding transcript	Het
Gm9956	T	A	10: 56,745,543	Y100*	probably null	Het
Gpr137c	T	A	14: 45,246,349	C178S	probably damaging	Het
Gpr83	A	G	9: 14,868,644	R331G	probably benign	Het
Hlcs	T	A	16: 94,131,852	H851L	probably damaging	Het
Kbtbd6	C	A	14: 79,451,884	Y6*	probably null	Het
Kif23	T	C	9: 61,925,032	R610G	possibly damaging	Het
Kifc3	G	A	8: 95,105,733	T487I	probably damaging	Het
Klra5	A	C	6: 129,908,796	D133E	possibly damaging	Het
Klra6	T	C	6: 130,022,705	E100G	probably damaging	Het
Klre1	T	A	6: 129,585,568		probably benign	Het
Lancl1	C	T	1: 67,009,910		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Man1b1	A	G	2: 25,338,155	I146V	possibly damaging	Het
Map4k5	T	A	12: 69,874,264		probably benign	Het
Mast3	A	G	8: 70,781,321	S178P	probably damaging	Het
Mau2	A	G	8: 70,023,612		probably null	Het
Mkrn2	A	T	6: 115,614,651	N312Y	probably damaging	Het
Mrvi1	T	C	7: 110,876,900	S615G	probably benign	Het
Myh1	A	G	11: 67,202,533	E150G	probably damaging	Het
Myo7b	T	A	18: 31,961,825		probably null	Het
Nyap1	A	G	5: 137,735,298	V491A	probably damaging	Het
Olfr1284	A	G	2: 111,379,293	M98V	probably damaging	Het
Olfr484	T	C	7: 108,124,734	I176M	probably benign	Het
Olfr518	A	T	7: 108,881,533	N24K	probably damaging	Het
Olfr954	T	C	9: 39,461,532	F34L	probably damaging	Het
Oxsm	A	T	14: 16,240,893	H385Q	probably damaging	Het
Pbld2	T	C	10: 63,056,811	S242P	probably damaging	Het
Pdzd7	T	C	19: 45,029,305	Y675C	probably damaging	Het
Pnkd	T	A	1: 74,351,541	H266Q	probably damaging	Het
Rbfox2	A	G	15: 77,099,279	S141P	probably benign	Het
Rdx	A	G	9: 52,068,218	T214A	probably benign	Het
Ripor2	A	T	13: 24,680,644	E219V	probably damaging	Het
Rufy2	G	A	10: 63,011,844		probably benign	Het
Slf2	T	A	19: 44,975,726		probably benign	Het
Snrnp200	G	T	2: 127,226,145		probably benign	Het
Snx7	T	A	3: 117,829,671		probably benign	Het
Stt3a	T	C	9: 36,735,512	I602V	probably damaging	Het
Tacr3	G	A	3: 134,855,000		probably null	Het
Tcerg1	C	T	18: 42,571,840	T978M	probably damaging	Het
Tcf7l1	G	T	6: 72,788,269	P126Q	possibly damaging	Het
Trank1	A	G	9: 111,365,488	D860G	probably damaging	Het
Try4	T	C	6: 41,304,367	L81P	probably benign	Het
Ucp1	T	C	8: 83,297,847		probably benign	Het
Ugt2b38	G	A	5: 87,420,452	A328V	probably damaging	Het
Wfikkn1	T	A	17: 25,878,017	R444S	probably damaging	Het
Zfc3h1	A	G	10: 115,410,632	T875A	probably benign	Het
Zfp11	A	G	5: 129,657,264	S378P	probably damaging	Het
Zfp984	T	A	4: 147,756,232	N54I	probably damaging	Het

Other mutations in Dctn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Dctn1	APN	6	83179897	missense	probably benign	0.00
IGL01450:Dctn1	APN	6	83194110	unclassified	probably benign
IGL01876:Dctn1	APN	6	83197921	missense	probably damaging	1.00
IGL01958:Dctn1	APN	6	83191344	missense	possibly damaging	0.95
IGL02554:Dctn1	APN	6	83182722	missense	probably damaging	1.00
IGL02668:Dctn1	APN	6	83191048	missense	possibly damaging	0.89
IGL02814:Dctn1	APN	6	83189914	missense	probably damaging	1.00
IGL02818:Dctn1	APN	6	83192514	missense	possibly damaging	0.86
IGL03007:Dctn1	APN	6	83182708	missense	probably damaging	1.00
IGL03065:Dctn1	APN	6	83192493	missense	probably damaging	0.99
IGL03083:Dctn1	APN	6	83197484	splice site	probably benign
IGL03394:Dctn1	APN	6	83191284	missense	possibly damaging	0.61
E0374:Dctn1	UTSW	6	83194174	missense	possibly damaging	0.93
IGL03014:Dctn1	UTSW	6	83197369	intron	probably benign
PIT4812001:Dctn1	UTSW	6	83199762	missense	possibly damaging	0.86
R0044:Dctn1	UTSW	6	83191134	missense	probably damaging	1.00
R0047:Dctn1	UTSW	6	83182632	nonsense	probably null
R0047:Dctn1	UTSW	6	83182632	nonsense	probably null
R0057:Dctn1	UTSW	6	83179892	missense	probably benign	0.14
R0738:Dctn1	UTSW	6	83190107	critical splice donor site	probably null
R0755:Dctn1	UTSW	6	83189077	missense	probably damaging	0.96
R0839:Dctn1	UTSW	6	83190477	missense	possibly damaging	0.53
R1035:Dctn1	UTSW	6	83190220	missense	probably damaging	1.00
R1454:Dctn1	UTSW	6	83197508	missense	possibly damaging	0.93
R1469:Dctn1	UTSW	6	83192889	missense	probably damaging	1.00
R1469:Dctn1	UTSW	6	83192889	missense	probably damaging	1.00
R1627:Dctn1	UTSW	6	83195082	missense	probably damaging	0.99
R1631:Dctn1	UTSW	6	83197596	missense	possibly damaging	0.56
R1812:Dctn1	UTSW	6	83192518	missense	possibly damaging	0.85
R1928:Dctn1	UTSW	6	83199184	splice site	probably benign
R2008:Dctn1	UTSW	6	83189956	missense	probably damaging	0.99
R2242:Dctn1	UTSW	6	83199705	missense	probably damaging	0.99
R2259:Dctn1	UTSW	6	83197586	missense	possibly damaging	0.46
R2422:Dctn1	UTSW	6	83199800	missense	possibly damaging	0.92
R2483:Dctn1	UTSW	6	83194187	missense	probably damaging	1.00
R4455:Dctn1	UTSW	6	83195049	missense	probably damaging	1.00
R4724:Dctn1	UTSW	6	83189938	missense	possibly damaging	0.53
R4812:Dctn1	UTSW	6	83189937	missense	probably benign	0.24
R4819:Dctn1	UTSW	6	83190519	missense	probably damaging	0.97
R4831:Dctn1	UTSW	6	83199771	missense	possibly damaging	0.46
R4928:Dctn1	UTSW	6	83189207	missense	possibly damaging	0.73
R5087:Dctn1	UTSW	6	83191639	missense	probably damaging	1.00
R5354:Dctn1	UTSW	6	83183126	missense	possibly damaging	0.93
R5372:Dctn1	UTSW	6	83190210	missense	probably damaging	0.96
R5493:Dctn1	UTSW	6	83182564	missense	possibly damaging	0.89
R5494:Dctn1	UTSW	6	83182564	missense	possibly damaging	0.89
R5732:Dctn1	UTSW	6	83197949	critical splice donor site	probably null
R5856:Dctn1	UTSW	6	83197865	missense	probably damaging	1.00
R6025:Dctn1	UTSW	6	83193691	splice site	probably null
R6999:Dctn1	UTSW	6	83191281	missense	possibly damaging	0.89
R7052:Dctn1	UTSW	6	83195280	splice site	probably null
R7133:Dctn1	UTSW	6	83180044	splice site	probably null
R7485:Dctn1	UTSW	6	83189905	missense	possibly damaging	0.85
R7607:Dctn1	UTSW	6	83195069	nonsense	probably null
R7729:Dctn1	UTSW	6	83183060	missense	probably damaging	1.00
R7749:Dctn1	UTSW	6	83186141	intron	probably benign
R8282:Dctn1	UTSW	6	83199756	missense	possibly damaging	0.91
R8750:Dctn1	UTSW	6	83183126	missense	possibly damaging	0.93
R9126:Dctn1	UTSW	6	83192853	missense	probably damaging	0.99
R9208:Dctn1	UTSW	6	83199702	missense	probably benign	0.33
R9422:Dctn1	UTSW	6	83193709	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- ACAAACATCTGTTGCTTGTGCTGC -3'
(R):5'- TGTGAACAAAAGAGCTGCTTCTCCC -3'

Sequencing Primer
(F):5'- AGTGTGTCCTTTTTCCTAAGTCG -3'
(R):5'- GGAAGCTGTCTACACATGTAACTC -3'

Posted On

2013-09-03