Incidental Mutation 'R8859:Rp1'
ID 675492
Institutional Source Beutler Lab
Gene Symbol Rp1
Ensembl Gene ENSMUSG00000025900
Gene Name retinitis pigmentosa 1 (human)
Synonyms Dcdc3, Orp1, mG145, Rp1h, oxygen-regulated protein 1
MMRRC Submission 068739-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R8859 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 4185896-4479508 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4420183 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 310 (S310P)
Ref Sequence ENSEMBL: ENSMUSP00000027032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]
AlphaFold P56716
Predicted Effect probably benign
Transcript: ENSMUST00000027032
AA Change: S310P

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: S310P

DomainStartEndE-ValueType
DCX 30 117 4.37e-39 SMART
low complexity region 120 133 N/A INTRINSIC
DCX 152 236 7.17e-35 SMART
low complexity region 343 354 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 646 661 N/A INTRINSIC
low complexity region 1113 1123 N/A INTRINSIC
low complexity region 1396 1412 N/A INTRINSIC
low complexity region 1434 1444 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194992
SMART Domains Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900

DomainStartEndE-ValueType
DCX 40 127 4.37e-39 SMART
low complexity region 130 143 N/A INTRINSIC
DCX 162 246 7.17e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208660
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,328,397 (GRCm39) Y3490F Het
Abcc1 T C 16: 14,214,225 (GRCm39) V167A probably benign Het
Abcd2 G A 15: 91,073,149 (GRCm39) R337C probably damaging Het
Adcy1 A G 11: 7,111,877 (GRCm39) D914G probably benign Het
Ahnak G T 19: 8,984,567 (GRCm39) L1950F probably damaging Het
Alox5ap T C 5: 149,201,994 (GRCm39) probably null Het
Ank C T 15: 27,562,834 (GRCm39) H181Y possibly damaging Het
Ankrd44 T A 1: 54,706,680 (GRCm39) D592V possibly damaging Het
Ap4m1 T A 5: 138,174,185 (GRCm39) N185K possibly damaging Het
Arhgef28 T A 13: 98,082,210 (GRCm39) D1199V probably damaging Het
Arnt T C 3: 95,397,691 (GRCm39) probably null Het
Atcay C T 10: 81,060,298 (GRCm39) V13M probably benign Het
B4galt3 T C 1: 171,099,241 (GRCm39) S2P unknown Het
Bicra A T 7: 15,721,737 (GRCm39) S593R possibly damaging Het
Brsk2 A C 7: 141,552,415 (GRCm39) Q633P probably damaging Het
Cacna1c T A 6: 118,653,280 (GRCm39) S909C Het
Ccdc7a G A 8: 129,788,113 (GRCm39) T72M probably benign Het
Ccn1 T C 3: 145,354,380 (GRCm39) D177G probably benign Het
Cct2 A T 10: 116,896,739 (GRCm39) F155I possibly damaging Het
Cdv3 G T 9: 103,233,594 (GRCm39) P194T probably damaging Het
Cenpc1 A T 5: 86,160,153 (GRCm39) V895E probably benign Het
Cep170b T C 12: 112,702,881 (GRCm39) V448A probably benign Het
Chil3 G A 3: 106,071,440 (GRCm39) R75C possibly damaging Het
Cnfn A T 7: 25,067,869 (GRCm39) C24S probably benign Het
Cnga3 A G 1: 37,299,852 (GRCm39) K191E possibly damaging Het
Col12a1 A T 9: 79,587,681 (GRCm39) Y1153* probably null Het
Coq4 C A 2: 29,685,491 (GRCm39) H168Q probably damaging Het
Dennd2b T A 7: 109,123,863 (GRCm39) K1132M probably damaging Het
Dnajc14 G A 10: 128,642,488 (GRCm39) V137I probably benign Het
Efr3a T C 15: 65,726,614 (GRCm39) L569P probably damaging Het
Epb41l3 A T 17: 69,591,575 (GRCm39) E677D probably benign Het
Esp8 G A 17: 40,841,013 (GRCm39) M91I unknown Het
Fubp1 A T 3: 151,937,669 (GRCm39) probably benign Het
Gldc G T 19: 30,116,779 (GRCm39) A391D probably damaging Het
Gm17728 A G 17: 9,641,027 (GRCm39) T46A probably benign Het
Gm5798 A G 14: 41,072,603 (GRCm39) K112E probably damaging Het
Gpnmb A G 6: 49,028,964 (GRCm39) probably benign Het
Grwd1 T C 7: 45,475,298 (GRCm39) T415A probably benign Het
Gsdma3 C G 11: 98,522,086 (GRCm39) A172G possibly damaging Het
Hltf C T 3: 20,119,566 (GRCm39) Q204* probably null Het
Igf1r T G 7: 67,833,211 (GRCm39) V457G possibly damaging Het
Inhbc A T 10: 127,192,984 (GRCm39) M344K probably damaging Het
Jak3 C T 8: 72,131,160 (GRCm39) A60V probably benign Het
Kif13b A G 14: 64,979,882 (GRCm39) T511A probably benign Het
Lama2 T A 10: 27,335,384 (GRCm39) N97I possibly damaging Het
Limd2 T A 11: 106,049,576 (GRCm39) D104V probably damaging Het
Loxl3 T A 6: 83,014,526 (GRCm39) C145S probably damaging Het
Lrrc37 A C 11: 103,506,370 (GRCm39) I1866S unknown Het
Lrrc73 A G 17: 46,565,455 (GRCm39) N62S probably benign Het
Lrrtm4 A G 6: 79,998,870 (GRCm39) D94G probably damaging Het
Lsm3 C A 6: 91,499,252 (GRCm39) F86L probably damaging Het
Map10 T C 8: 126,397,291 (GRCm39) V228A probably benign Het
Mcidas A C 13: 113,130,664 (GRCm39) S54R possibly damaging Het
Me3 T C 7: 89,455,876 (GRCm39) Y243H probably damaging Het
Mgat4b A G 11: 50,121,674 (GRCm39) T89A possibly damaging Het
Mmp16 T A 4: 18,054,355 (GRCm39) probably benign Het
Mtmr9 G A 14: 63,781,226 (GRCm39) probably benign Het
Myo1b G T 1: 51,836,198 (GRCm39) A331E probably damaging Het
Ncoa6 C T 2: 155,248,388 (GRCm39) V1639M possibly damaging Het
Nek9 C T 12: 85,353,120 (GRCm39) G752R probably damaging Het
Nufip2 A G 11: 77,584,069 (GRCm39) Y661C probably benign Het
Or10w1 T A 19: 13,632,246 (GRCm39) V151E probably damaging Het
Or1n2 C T 2: 36,797,516 (GRCm39) A186V possibly damaging Het
Or51t4 A T 7: 102,598,373 (GRCm39) I234F probably damaging Het
Or7g16 T C 9: 18,726,992 (GRCm39) I199M possibly damaging Het
Or8g55 G A 9: 39,784,894 (GRCm39) G108S probably benign Het
Oxct2a A G 4: 123,216,322 (GRCm39) L353S probably benign Het
Parvg A G 15: 84,222,001 (GRCm39) I243V probably benign Het
Pcdhgb7 C A 18: 37,886,349 (GRCm39) N506K possibly damaging Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Pgghg G A 7: 140,525,367 (GRCm39) probably null Het
Phrf1 G T 7: 140,836,516 (GRCm39) G263W unknown Het
Ppfia1 A C 7: 144,032,762 (GRCm39) probably null Het
Prss37 T A 6: 40,491,897 (GRCm39) I228F probably damaging Het
Ptpro A T 6: 137,403,782 (GRCm39) K921* probably null Het
Rictor T G 15: 6,813,067 (GRCm39) L940R probably damaging Het
Ryr3 A G 2: 112,483,564 (GRCm39) V4091A probably damaging Het
Saxo4 T A 19: 10,459,599 (GRCm39) Y36F probably damaging Het
Sirt5 T A 13: 43,524,327 (GRCm39) M33K possibly damaging Het
Slc25a30 T A 14: 76,008,917 (GRCm39) Y90F probably benign Het
Stimate T A 14: 30,588,629 (GRCm39) Y119N probably damaging Het
Stk11 G A 10: 79,964,269 (GRCm39) D388N probably benign Het
Tgm1 C A 14: 55,949,686 (GRCm39) R126L probably benign Het
Tmem129 G T 5: 33,811,837 (GRCm39) T321N probably benign Het
Tnfrsf11a A T 1: 105,772,244 (GRCm39) probably null Het
Tor1aip1 A G 1: 155,907,190 (GRCm39) C195R probably benign Het
Tpr A G 1: 150,284,597 (GRCm39) E428G possibly damaging Het
Trps1 T A 15: 50,685,769 (GRCm39) D802V possibly damaging Het
Usp17lc T A 7: 103,064,316 (GRCm39) S6T probably benign Het
Vangl1 C A 3: 102,065,758 (GRCm39) R459L Het
Vmn1r43 T C 6: 89,846,937 (GRCm39) Y183C probably damaging Het
Vmn2r110 C T 17: 20,794,560 (GRCm39) C703Y probably damaging Het
Vmn2r54 T C 7: 12,363,702 (GRCm39) Q397R possibly damaging Het
Vmn2r88 T C 14: 51,656,263 (GRCm39) V824A probably damaging Het
Vmn2r89 A T 14: 51,693,170 (GRCm39) Y79F probably benign Het
Vnn1 T C 10: 23,780,484 (GRCm39) S491P probably benign Het
Zbbx A G 3: 74,968,741 (GRCm39) F572L unknown Het
Zc3h4 A T 7: 16,168,939 (GRCm39) Q1091L unknown Het
Zfp503 C T 14: 22,037,286 (GRCm39) V106I possibly damaging Het
Zfp874a T C 13: 67,590,647 (GRCm39) T346A probably benign Het
Other mutations in Rp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rp1 APN 1 4,416,969 (GRCm39) missense probably damaging 0.98
IGL00593:Rp1 APN 1 4,415,626 (GRCm39) missense possibly damaging 0.70
IGL00956:Rp1 APN 1 4,422,435 (GRCm39) missense probably damaging 1.00
IGL01070:Rp1 APN 1 4,415,461 (GRCm39) missense probably damaging 1.00
IGL01531:Rp1 APN 1 4,419,168 (GRCm39) missense probably benign 0.00
IGL01668:Rp1 APN 1 4,415,941 (GRCm39) missense probably damaging 1.00
IGL01907:Rp1 APN 1 4,418,730 (GRCm39) missense possibly damaging 0.56
IGL02055:Rp1 APN 1 4,422,745 (GRCm39) missense probably damaging 1.00
IGL02071:Rp1 APN 1 4,415,533 (GRCm39) missense possibly damaging 0.46
IGL02128:Rp1 APN 1 4,417,608 (GRCm39) missense probably damaging 0.99
IGL02244:Rp1 APN 1 4,419,003 (GRCm39) missense probably benign 0.00
IGL02381:Rp1 APN 1 4,422,613 (GRCm39) missense probably benign 0.01
IGL02499:Rp1 APN 1 4,419,271 (GRCm39) missense probably benign 0.17
IGL02619:Rp1 APN 1 4,418,673 (GRCm39) missense possibly damaging 0.73
IGL02832:Rp1 APN 1 4,419,936 (GRCm39) missense probably benign 0.03
IGL02861:Rp1 APN 1 4,416,375 (GRCm39) nonsense probably null
IGL03288:Rp1 APN 1 4,419,747 (GRCm39) missense possibly damaging 0.88
IGL03290:Rp1 APN 1 4,420,264 (GRCm39) missense probably damaging 1.00
IGL03303:Rp1 APN 1 4,415,040 (GRCm39) missense probably damaging 1.00
R0041:Rp1 UTSW 1 4,414,851 (GRCm39) missense probably benign 0.36
R0111:Rp1 UTSW 1 4,414,983 (GRCm39) missense probably damaging 1.00
R0363:Rp1 UTSW 1 4,417,941 (GRCm39) missense probably damaging 1.00
R0440:Rp1 UTSW 1 4,415,863 (GRCm39) missense probably damaging 1.00
R0442:Rp1 UTSW 1 4,416,970 (GRCm39) missense probably benign 0.09
R0528:Rp1 UTSW 1 4,415,088 (GRCm39) missense possibly damaging 0.82
R0586:Rp1 UTSW 1 4,418,060 (GRCm39) missense possibly damaging 0.76
R0639:Rp1 UTSW 1 4,416,721 (GRCm39) missense probably benign 0.00
R0856:Rp1 UTSW 1 4,414,878 (GRCm39) missense probably benign 0.05
R0908:Rp1 UTSW 1 4,414,878 (GRCm39) missense probably benign 0.05
R0968:Rp1 UTSW 1 4,415,575 (GRCm39) missense probably benign 0.00
R1099:Rp1 UTSW 1 4,422,513 (GRCm39) missense possibly damaging 0.45
R1242:Rp1 UTSW 1 4,415,185 (GRCm39) missense probably benign 0.03
R1301:Rp1 UTSW 1 4,416,159 (GRCm39) missense possibly damaging 0.56
R1327:Rp1 UTSW 1 4,418,193 (GRCm39) missense probably benign 0.01
R1403:Rp1 UTSW 1 4,416,520 (GRCm39) missense possibly damaging 0.73
R1403:Rp1 UTSW 1 4,416,520 (GRCm39) missense possibly damaging 0.73
R1406:Rp1 UTSW 1 4,422,144 (GRCm39) missense possibly damaging 0.88
R1406:Rp1 UTSW 1 4,422,144 (GRCm39) missense possibly damaging 0.88
R1440:Rp1 UTSW 1 4,417,619 (GRCm39) missense probably damaging 1.00
R1509:Rp1 UTSW 1 4,418,760 (GRCm39) missense probably benign 0.20
R1509:Rp1 UTSW 1 4,417,917 (GRCm39) missense probably damaging 0.98
R1538:Rp1 UTSW 1 4,415,899 (GRCm39) missense probably damaging 1.00
R1609:Rp1 UTSW 1 4,419,424 (GRCm39) missense probably damaging 1.00
R1666:Rp1 UTSW 1 4,420,086 (GRCm39) missense probably damaging 1.00
R1703:Rp1 UTSW 1 4,415,392 (GRCm39) missense probably damaging 1.00
R1782:Rp1 UTSW 1 4,419,312 (GRCm39) missense probably benign 0.00
R1799:Rp1 UTSW 1 4,419,055 (GRCm39) missense possibly damaging 0.94
R1848:Rp1 UTSW 1 4,417,455 (GRCm39) missense possibly damaging 0.76
R1908:Rp1 UTSW 1 4,418,943 (GRCm39) missense probably damaging 0.99
R1919:Rp1 UTSW 1 4,422,894 (GRCm39) missense probably damaging 0.99
R2087:Rp1 UTSW 1 4,418,575 (GRCm39) missense probably damaging 1.00
R2211:Rp1 UTSW 1 4,418,362 (GRCm39) missense probably damaging 0.96
R2278:Rp1 UTSW 1 4,418,250 (GRCm39) missense possibly damaging 0.51
R2287:Rp1 UTSW 1 4,416,182 (GRCm39) nonsense probably null
R2316:Rp1 UTSW 1 4,415,863 (GRCm39) missense probably damaging 1.00
R2346:Rp1 UTSW 1 4,418,236 (GRCm39) missense probably damaging 1.00
R2878:Rp1 UTSW 1 4,418,362 (GRCm39) missense probably damaging 1.00
R3023:Rp1 UTSW 1 4,422,898 (GRCm39) missense probably damaging 1.00
R3025:Rp1 UTSW 1 4,422,898 (GRCm39) missense probably damaging 1.00
R3716:Rp1 UTSW 1 4,419,988 (GRCm39) missense probably benign 0.38
R3814:Rp1 UTSW 1 4,419,931 (GRCm39) missense probably benign
R3929:Rp1 UTSW 1 4,422,868 (GRCm39) missense probably damaging 1.00
R4064:Rp1 UTSW 1 4,415,623 (GRCm39) missense probably benign 0.08
R4426:Rp1 UTSW 1 4,418,147 (GRCm39) missense probably benign 0.13
R4557:Rp1 UTSW 1 4,414,886 (GRCm39) missense possibly damaging 0.61
R4764:Rp1 UTSW 1 4,416,101 (GRCm39) missense probably damaging 0.96
R4845:Rp1 UTSW 1 4,419,451 (GRCm39) missense probably benign 0.02
R4850:Rp1 UTSW 1 4,418,898 (GRCm39) missense probably damaging 1.00
R4857:Rp1 UTSW 1 4,422,540 (GRCm39) missense probably damaging 1.00
R4857:Rp1 UTSW 1 4,422,539 (GRCm39) missense probably damaging 0.99
R5159:Rp1 UTSW 1 4,416,426 (GRCm39) missense possibly damaging 0.73
R5226:Rp1 UTSW 1 4,418,256 (GRCm39) missense probably benign 0.01
R5327:Rp1 UTSW 1 4,419,583 (GRCm39) splice site probably null
R5352:Rp1 UTSW 1 4,417,321 (GRCm39) missense probably benign 0.00
R5504:Rp1 UTSW 1 4,420,113 (GRCm39) missense probably damaging 1.00
R5527:Rp1 UTSW 1 4,416,616 (GRCm39) missense possibly damaging 0.75
R5529:Rp1 UTSW 1 4,416,055 (GRCm39) missense probably benign 0.42
R5569:Rp1 UTSW 1 4,415,460 (GRCm39) missense probably damaging 1.00
R5622:Rp1 UTSW 1 4,418,060 (GRCm39) missense possibly damaging 0.76
R5970:Rp1 UTSW 1 4,418,685 (GRCm39) missense probably benign 0.05
R5992:Rp1 UTSW 1 4,218,926 (GRCm39) missense unknown
R6004:Rp1 UTSW 1 4,267,808 (GRCm39) missense unknown
R6018:Rp1 UTSW 1 4,423,059 (GRCm39) missense possibly damaging 0.83
R6074:Rp1 UTSW 1 4,415,602 (GRCm39) missense probably benign 0.02
R6127:Rp1 UTSW 1 4,419,534 (GRCm39) missense possibly damaging 0.80
R6187:Rp1 UTSW 1 4,420,092 (GRCm39) missense probably damaging 1.00
R6301:Rp1 UTSW 1 4,417,477 (GRCm39) missense probably benign 0.04
R6317:Rp1 UTSW 1 4,112,212 (GRCm39) missense unknown
R6405:Rp1 UTSW 1 4,415,994 (GRCm39) missense probably damaging 1.00
R6445:Rp1 UTSW 1 4,296,840 (GRCm39) missense unknown
R6466:Rp1 UTSW 1 4,418,109 (GRCm39) missense probably benign 0.01
R6501:Rp1 UTSW 1 4,381,503 (GRCm39) intron probably benign
R6547:Rp1 UTSW 1 4,240,528 (GRCm39) missense unknown
R6604:Rp1 UTSW 1 4,089,351 (GRCm39) missense unknown
R6700:Rp1 UTSW 1 4,420,119 (GRCm39) missense probably damaging 1.00
R6706:Rp1 UTSW 1 4,212,887 (GRCm39) missense unknown
R6831:Rp1 UTSW 1 4,420,087 (GRCm39) splice site probably null
R6918:Rp1 UTSW 1 4,069,831 (GRCm39) missense unknown
R6973:Rp1 UTSW 1 4,422,217 (GRCm39) nonsense probably null
R6981:Rp1 UTSW 1 4,415,878 (GRCm39) missense probably benign 0.06
R7009:Rp1 UTSW 1 4,112,291 (GRCm39) missense unknown
R7078:Rp1 UTSW 1 4,277,014 (GRCm39) missense unknown
R7112:Rp1 UTSW 1 4,419,241 (GRCm39) missense probably benign 0.43
R7135:Rp1 UTSW 1 4,418,391 (GRCm39) missense possibly damaging 0.83
R7165:Rp1 UTSW 1 4,420,140 (GRCm39) missense probably damaging 0.99
R7199:Rp1 UTSW 1 4,417,513 (GRCm39) missense possibly damaging 0.73
R7232:Rp1 UTSW 1 4,298,824 (GRCm39) missense unknown
R7367:Rp1 UTSW 1 4,418,221 (GRCm39) missense probably benign 0.42
R7484:Rp1 UTSW 1 4,415,704 (GRCm39) missense probably benign 0.10
R7500:Rp1 UTSW 1 4,381,501 (GRCm39) missense unknown
R7569:Rp1 UTSW 1 4,355,063 (GRCm39) missense unknown
R7642:Rp1 UTSW 1 4,218,054 (GRCm39) missense unknown
R7693:Rp1 UTSW 1 4,417,626 (GRCm39) missense probably damaging 1.00
R7742:Rp1 UTSW 1 4,240,457 (GRCm39) missense unknown
R7759:Rp1 UTSW 1 4,415,107 (GRCm39) missense probably benign
R7784:Rp1 UTSW 1 4,212,881 (GRCm39) missense unknown
R7816:Rp1 UTSW 1 4,417,926 (GRCm39) missense probably damaging 0.98
R7866:Rp1 UTSW 1 4,417,924 (GRCm39) missense probably benign 0.02
R8215:Rp1 UTSW 1 4,315,318 (GRCm39) missense unknown
R8281:Rp1 UTSW 1 4,418,139 (GRCm39) missense probably damaging 1.00
R8294:Rp1 UTSW 1 4,416,220 (GRCm39) missense probably benign 0.09
R8309:Rp1 UTSW 1 4,417,312 (GRCm39) missense probably benign 0.00
R8311:Rp1 UTSW 1 4,418,572 (GRCm39) missense probably benign 0.11
R8500:Rp1 UTSW 1 4,416,813 (GRCm39) missense possibly damaging 0.91
R8559:Rp1 UTSW 1 4,419,784 (GRCm39) missense probably damaging 1.00
R8672:Rp1 UTSW 1 4,419,007 (GRCm39) missense possibly damaging 0.55
R8688:Rp1 UTSW 1 4,416,628 (GRCm39) missense probably benign 0.01
R8792:Rp1 UTSW 1 4,095,091 (GRCm39) missense unknown
R8945:Rp1 UTSW 1 4,419,817 (GRCm39) missense probably benign 0.42
R8959:Rp1 UTSW 1 4,419,650 (GRCm39) intron probably benign
R8979:Rp1 UTSW 1 4,218,937 (GRCm39) missense unknown
R9126:Rp1 UTSW 1 4,417,136 (GRCm39) missense probably damaging 0.99
R9156:Rp1 UTSW 1 4,234,161 (GRCm39) missense unknown
R9160:Rp1 UTSW 1 4,416,720 (GRCm39) missense probably benign 0.00
R9221:Rp1 UTSW 1 4,315,266 (GRCm39) missense unknown
R9263:Rp1 UTSW 1 4,419,160 (GRCm39) missense probably benign 0.02
R9263:Rp1 UTSW 1 4,418,675 (GRCm39) missense probably benign 0.25
R9302:Rp1 UTSW 1 4,416,789 (GRCm39) missense probably damaging 1.00
R9318:Rp1 UTSW 1 4,418,488 (GRCm39) missense probably benign 0.09
R9414:Rp1 UTSW 1 4,313,841 (GRCm39) missense unknown
R9474:Rp1 UTSW 1 4,162,838 (GRCm39) critical splice donor site probably null
R9478:Rp1 UTSW 1 4,417,545 (GRCm39) missense probably benign 0.06
R9529:Rp1 UTSW 1 4,416,447 (GRCm39) missense probably benign
R9572:Rp1 UTSW 1 4,418,662 (GRCm39) missense probably benign
R9673:Rp1 UTSW 1 4,337,792 (GRCm39) missense unknown
R9709:Rp1 UTSW 1 4,112,255 (GRCm39) missense unknown
R9716:Rp1 UTSW 1 4,212,833 (GRCm39) critical splice donor site probably null
RF003:Rp1 UTSW 1 4,414,917 (GRCm39) missense probably damaging 0.99
V1662:Rp1 UTSW 1 4,419,783 (GRCm39) missense probably damaging 1.00
X0012:Rp1 UTSW 1 4,417,918 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGGCAACGAACATGCTTC -3'
(R):5'- CCTTGGGATATTTACAACTTCTGTGC -3'

Sequencing Primer
(F):5'- GCTTCAAGCTTTAAACTAGATGGTCC -3'
(R):5'- GGATATTTACAACTTCTGTGCTTTCC -3'
Posted On 2021-07-15