Incidental Mutation 'R8859:Tpr'
ID 675497
Institutional Source Beutler Lab
Gene Symbol Tpr
Ensembl Gene ENSMUSG00000006005
Gene Name translocated promoter region, nuclear basket protein
Synonyms 2610029M07Rik
MMRRC Submission 068739-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8859 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 150268589-150325686 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 150284597 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 428 (E428G)
Ref Sequence ENSEMBL: ENSMUSP00000117616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124973]
AlphaFold F6ZDS4
Predicted Effect possibly damaging
Transcript: ENSMUST00000119161
AA Change: E354G

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: E354G

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124973
AA Change: E428G

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: E428G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,328,397 (GRCm39) Y3490F Het
Abcc1 T C 16: 14,214,225 (GRCm39) V167A probably benign Het
Abcd2 G A 15: 91,073,149 (GRCm39) R337C probably damaging Het
Adcy1 A G 11: 7,111,877 (GRCm39) D914G probably benign Het
Ahnak G T 19: 8,984,567 (GRCm39) L1950F probably damaging Het
Alox5ap T C 5: 149,201,994 (GRCm39) probably null Het
Ank C T 15: 27,562,834 (GRCm39) H181Y possibly damaging Het
Ankrd44 T A 1: 54,706,680 (GRCm39) D592V possibly damaging Het
Ap4m1 T A 5: 138,174,185 (GRCm39) N185K possibly damaging Het
Arhgef28 T A 13: 98,082,210 (GRCm39) D1199V probably damaging Het
Arnt T C 3: 95,397,691 (GRCm39) probably null Het
Atcay C T 10: 81,060,298 (GRCm39) V13M probably benign Het
B4galt3 T C 1: 171,099,241 (GRCm39) S2P unknown Het
Bicra A T 7: 15,721,737 (GRCm39) S593R possibly damaging Het
Brsk2 A C 7: 141,552,415 (GRCm39) Q633P probably damaging Het
Cacna1c T A 6: 118,653,280 (GRCm39) S909C Het
Ccdc7a G A 8: 129,788,113 (GRCm39) T72M probably benign Het
Ccn1 T C 3: 145,354,380 (GRCm39) D177G probably benign Het
Cct2 A T 10: 116,896,739 (GRCm39) F155I possibly damaging Het
Cdv3 G T 9: 103,233,594 (GRCm39) P194T probably damaging Het
Cenpc1 A T 5: 86,160,153 (GRCm39) V895E probably benign Het
Cep170b T C 12: 112,702,881 (GRCm39) V448A probably benign Het
Chil3 G A 3: 106,071,440 (GRCm39) R75C possibly damaging Het
Cnfn A T 7: 25,067,869 (GRCm39) C24S probably benign Het
Cnga3 A G 1: 37,299,852 (GRCm39) K191E possibly damaging Het
Col12a1 A T 9: 79,587,681 (GRCm39) Y1153* probably null Het
Coq4 C A 2: 29,685,491 (GRCm39) H168Q probably damaging Het
Dennd2b T A 7: 109,123,863 (GRCm39) K1132M probably damaging Het
Dnajc14 G A 10: 128,642,488 (GRCm39) V137I probably benign Het
Efr3a T C 15: 65,726,614 (GRCm39) L569P probably damaging Het
Epb41l3 A T 17: 69,591,575 (GRCm39) E677D probably benign Het
Esp8 G A 17: 40,841,013 (GRCm39) M91I unknown Het
Fubp1 A T 3: 151,937,669 (GRCm39) probably benign Het
Gldc G T 19: 30,116,779 (GRCm39) A391D probably damaging Het
Gm17728 A G 17: 9,641,027 (GRCm39) T46A probably benign Het
Gm5798 A G 14: 41,072,603 (GRCm39) K112E probably damaging Het
Gpnmb A G 6: 49,028,964 (GRCm39) probably benign Het
Grwd1 T C 7: 45,475,298 (GRCm39) T415A probably benign Het
Gsdma3 C G 11: 98,522,086 (GRCm39) A172G possibly damaging Het
Hltf C T 3: 20,119,566 (GRCm39) Q204* probably null Het
Igf1r T G 7: 67,833,211 (GRCm39) V457G possibly damaging Het
Inhbc A T 10: 127,192,984 (GRCm39) M344K probably damaging Het
Jak3 C T 8: 72,131,160 (GRCm39) A60V probably benign Het
Kif13b A G 14: 64,979,882 (GRCm39) T511A probably benign Het
Lama2 T A 10: 27,335,384 (GRCm39) N97I possibly damaging Het
Limd2 T A 11: 106,049,576 (GRCm39) D104V probably damaging Het
Loxl3 T A 6: 83,014,526 (GRCm39) C145S probably damaging Het
Lrrc37 A C 11: 103,506,370 (GRCm39) I1866S unknown Het
Lrrc73 A G 17: 46,565,455 (GRCm39) N62S probably benign Het
Lrrtm4 A G 6: 79,998,870 (GRCm39) D94G probably damaging Het
Lsm3 C A 6: 91,499,252 (GRCm39) F86L probably damaging Het
Map10 T C 8: 126,397,291 (GRCm39) V228A probably benign Het
Mcidas A C 13: 113,130,664 (GRCm39) S54R possibly damaging Het
Me3 T C 7: 89,455,876 (GRCm39) Y243H probably damaging Het
Mgat4b A G 11: 50,121,674 (GRCm39) T89A possibly damaging Het
Mmp16 T A 4: 18,054,355 (GRCm39) probably benign Het
Mtmr9 G A 14: 63,781,226 (GRCm39) probably benign Het
Myo1b G T 1: 51,836,198 (GRCm39) A331E probably damaging Het
Ncoa6 C T 2: 155,248,388 (GRCm39) V1639M possibly damaging Het
Nek9 C T 12: 85,353,120 (GRCm39) G752R probably damaging Het
Nufip2 A G 11: 77,584,069 (GRCm39) Y661C probably benign Het
Or10w1 T A 19: 13,632,246 (GRCm39) V151E probably damaging Het
Or1n2 C T 2: 36,797,516 (GRCm39) A186V possibly damaging Het
Or51t4 A T 7: 102,598,373 (GRCm39) I234F probably damaging Het
Or7g16 T C 9: 18,726,992 (GRCm39) I199M possibly damaging Het
Or8g55 G A 9: 39,784,894 (GRCm39) G108S probably benign Het
Oxct2a A G 4: 123,216,322 (GRCm39) L353S probably benign Het
Parvg A G 15: 84,222,001 (GRCm39) I243V probably benign Het
Pcdhgb7 C A 18: 37,886,349 (GRCm39) N506K possibly damaging Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Pgghg G A 7: 140,525,367 (GRCm39) probably null Het
Phrf1 G T 7: 140,836,516 (GRCm39) G263W unknown Het
Ppfia1 A C 7: 144,032,762 (GRCm39) probably null Het
Prss37 T A 6: 40,491,897 (GRCm39) I228F probably damaging Het
Ptpro A T 6: 137,403,782 (GRCm39) K921* probably null Het
Rictor T G 15: 6,813,067 (GRCm39) L940R probably damaging Het
Rp1 A G 1: 4,420,183 (GRCm39) S310P probably benign Het
Ryr3 A G 2: 112,483,564 (GRCm39) V4091A probably damaging Het
Saxo4 T A 19: 10,459,599 (GRCm39) Y36F probably damaging Het
Sirt5 T A 13: 43,524,327 (GRCm39) M33K possibly damaging Het
Slc25a30 T A 14: 76,008,917 (GRCm39) Y90F probably benign Het
Stimate T A 14: 30,588,629 (GRCm39) Y119N probably damaging Het
Stk11 G A 10: 79,964,269 (GRCm39) D388N probably benign Het
Tgm1 C A 14: 55,949,686 (GRCm39) R126L probably benign Het
Tmem129 G T 5: 33,811,837 (GRCm39) T321N probably benign Het
Tnfrsf11a A T 1: 105,772,244 (GRCm39) probably null Het
Tor1aip1 A G 1: 155,907,190 (GRCm39) C195R probably benign Het
Trps1 T A 15: 50,685,769 (GRCm39) D802V possibly damaging Het
Usp17lc T A 7: 103,064,316 (GRCm39) S6T probably benign Het
Vangl1 C A 3: 102,065,758 (GRCm39) R459L Het
Vmn1r43 T C 6: 89,846,937 (GRCm39) Y183C probably damaging Het
Vmn2r110 C T 17: 20,794,560 (GRCm39) C703Y probably damaging Het
Vmn2r54 T C 7: 12,363,702 (GRCm39) Q397R possibly damaging Het
Vmn2r88 T C 14: 51,656,263 (GRCm39) V824A probably damaging Het
Vmn2r89 A T 14: 51,693,170 (GRCm39) Y79F probably benign Het
Vnn1 T C 10: 23,780,484 (GRCm39) S491P probably benign Het
Zbbx A G 3: 74,968,741 (GRCm39) F572L unknown Het
Zc3h4 A T 7: 16,168,939 (GRCm39) Q1091L unknown Het
Zfp503 C T 14: 22,037,286 (GRCm39) V106I possibly damaging Het
Zfp874a T C 13: 67,590,647 (GRCm39) T346A probably benign Het
Other mutations in Tpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Tpr APN 1 150,299,447 (GRCm39) splice site probably benign
IGL00424:Tpr APN 1 150,274,346 (GRCm39) splice site probably benign
IGL01095:Tpr APN 1 150,285,891 (GRCm39) missense possibly damaging 0.95
IGL01347:Tpr APN 1 150,302,738 (GRCm39) missense probably damaging 1.00
IGL01519:Tpr APN 1 150,306,919 (GRCm39) missense probably benign 0.01
IGL01768:Tpr APN 1 150,320,199 (GRCm39) missense possibly damaging 0.85
IGL01939:Tpr APN 1 150,289,496 (GRCm39) missense possibly damaging 0.82
IGL01988:Tpr APN 1 150,302,750 (GRCm39) splice site probably null
IGL02065:Tpr APN 1 150,289,525 (GRCm39) missense probably benign 0.13
IGL02110:Tpr APN 1 150,311,493 (GRCm39) missense probably damaging 0.97
IGL02311:Tpr APN 1 150,274,404 (GRCm39) missense probably damaging 0.97
IGL02454:Tpr APN 1 150,306,943 (GRCm39) missense probably benign 0.00
IGL02569:Tpr APN 1 150,301,382 (GRCm39) unclassified probably benign
IGL03168:Tpr APN 1 150,284,508 (GRCm39) missense probably benign 0.04
IGL03193:Tpr APN 1 150,315,831 (GRCm39) missense possibly damaging 0.85
IGL03333:Tpr APN 1 150,302,718 (GRCm39) missense probably benign 0.04
gridiron UTSW 1 150,299,267 (GRCm39) missense probably damaging 1.00
Pouch UTSW 1 150,309,523 (GRCm39) missense probably damaging 1.00
punt UTSW 1 150,293,790 (GRCm39) missense probably benign 0.02
Turf UTSW 1 150,317,996 (GRCm39) critical splice donor site probably null
F6893:Tpr UTSW 1 150,269,313 (GRCm39) missense possibly damaging 0.84
PIT4305001:Tpr UTSW 1 150,315,888 (GRCm39) missense possibly damaging 0.85
PIT4469001:Tpr UTSW 1 150,279,707 (GRCm39) missense probably benign 0.41
R0085:Tpr UTSW 1 150,293,164 (GRCm39) missense possibly damaging 0.95
R0101:Tpr UTSW 1 150,285,053 (GRCm39) splice site probably benign
R0116:Tpr UTSW 1 150,285,898 (GRCm39) missense probably damaging 0.98
R0136:Tpr UTSW 1 150,306,346 (GRCm39) missense probably benign 0.01
R0207:Tpr UTSW 1 150,293,178 (GRCm39) missense possibly damaging 0.74
R0219:Tpr UTSW 1 150,319,009 (GRCm39) splice site probably null
R0380:Tpr UTSW 1 150,288,698 (GRCm39) missense probably benign 0.27
R0403:Tpr UTSW 1 150,283,165 (GRCm39) splice site probably benign
R0469:Tpr UTSW 1 150,299,418 (GRCm39) frame shift probably null
R0480:Tpr UTSW 1 150,303,992 (GRCm39) missense possibly damaging 0.83
R0514:Tpr UTSW 1 150,278,024 (GRCm39) missense possibly damaging 0.55
R0563:Tpr UTSW 1 150,284,609 (GRCm39) missense probably benign 0.13
R0631:Tpr UTSW 1 150,298,282 (GRCm39) missense probably damaging 0.98
R0685:Tpr UTSW 1 150,309,476 (GRCm39) missense possibly damaging 0.69
R0730:Tpr UTSW 1 150,269,158 (GRCm39) utr 5 prime probably benign
R0739:Tpr UTSW 1 150,283,248 (GRCm39) missense possibly damaging 0.94
R0780:Tpr UTSW 1 150,307,092 (GRCm39) missense probably benign 0.00
R1018:Tpr UTSW 1 150,317,934 (GRCm39) missense possibly damaging 0.53
R1084:Tpr UTSW 1 150,317,912 (GRCm39) missense probably benign 0.18
R1532:Tpr UTSW 1 150,293,751 (GRCm39) missense probably damaging 0.99
R1551:Tpr UTSW 1 150,312,552 (GRCm39) missense probably benign 0.00
R1608:Tpr UTSW 1 150,302,644 (GRCm39) missense probably damaging 0.96
R1759:Tpr UTSW 1 150,305,275 (GRCm39) missense probably benign 0.19
R1817:Tpr UTSW 1 150,295,654 (GRCm39) missense probably damaging 0.98
R1932:Tpr UTSW 1 150,297,414 (GRCm39) missense probably benign 0.00
R1978:Tpr UTSW 1 150,295,658 (GRCm39) missense possibly damaging 0.65
R2031:Tpr UTSW 1 150,317,870 (GRCm39) missense probably benign
R2176:Tpr UTSW 1 150,295,691 (GRCm39) missense possibly damaging 0.56
R2235:Tpr UTSW 1 150,317,843 (GRCm39) missense probably benign 0.33
R2339:Tpr UTSW 1 150,289,525 (GRCm39) missense probably benign 0.01
R2367:Tpr UTSW 1 150,309,479 (GRCm39) missense probably damaging 0.99
R2507:Tpr UTSW 1 150,268,695 (GRCm39) start codon destroyed probably null
R3931:Tpr UTSW 1 150,311,655 (GRCm39) missense probably damaging 1.00
R4320:Tpr UTSW 1 150,299,325 (GRCm39) missense possibly damaging 0.96
R4439:Tpr UTSW 1 150,279,712 (GRCm39) missense probably benign 0.01
R4568:Tpr UTSW 1 150,268,710 (GRCm39) unclassified probably benign
R4644:Tpr UTSW 1 150,299,250 (GRCm39) missense probably benign 0.01
R4665:Tpr UTSW 1 150,320,150 (GRCm39) missense probably damaging 0.97
R4672:Tpr UTSW 1 150,299,318 (GRCm39) missense probably benign 0.45
R4673:Tpr UTSW 1 150,299,318 (GRCm39) missense probably benign 0.45
R4735:Tpr UTSW 1 150,317,947 (GRCm39) missense possibly damaging 0.91
R4767:Tpr UTSW 1 150,306,280 (GRCm39) intron probably benign
R4772:Tpr UTSW 1 150,288,864 (GRCm39) missense possibly damaging 0.46
R4815:Tpr UTSW 1 150,274,359 (GRCm39) missense probably benign 0.01
R4839:Tpr UTSW 1 150,324,948 (GRCm39) nonsense probably null
R4844:Tpr UTSW 1 150,321,630 (GRCm39) missense possibly damaging 0.86
R4925:Tpr UTSW 1 150,308,316 (GRCm39) missense probably benign 0.00
R4967:Tpr UTSW 1 150,285,810 (GRCm39) missense probably damaging 0.99
R5017:Tpr UTSW 1 150,274,388 (GRCm39) missense probably benign 0.00
R5096:Tpr UTSW 1 150,321,953 (GRCm39) missense probably damaging 0.99
R5353:Tpr UTSW 1 150,321,675 (GRCm39) missense probably damaging 1.00
R5354:Tpr UTSW 1 150,321,675 (GRCm39) missense probably damaging 1.00
R5484:Tpr UTSW 1 150,302,639 (GRCm39) missense probably benign 0.33
R5601:Tpr UTSW 1 150,311,604 (GRCm39) missense possibly damaging 0.75
R5642:Tpr UTSW 1 150,299,569 (GRCm39) missense probably damaging 0.99
R5779:Tpr UTSW 1 150,299,292 (GRCm39) missense probably damaging 1.00
R5787:Tpr UTSW 1 150,271,037 (GRCm39) missense probably benign 0.01
R5892:Tpr UTSW 1 150,283,151 (GRCm39) missense probably benign 0.44
R5915:Tpr UTSW 1 150,301,400 (GRCm39) missense probably benign 0.15
R5928:Tpr UTSW 1 150,303,878 (GRCm39) missense probably benign 0.30
R6146:Tpr UTSW 1 150,298,913 (GRCm39) missense possibly damaging 0.83
R6154:Tpr UTSW 1 150,299,567 (GRCm39) missense probably benign 0.00
R6234:Tpr UTSW 1 150,293,790 (GRCm39) missense probably benign 0.02
R6263:Tpr UTSW 1 150,317,996 (GRCm39) critical splice donor site probably null
R6318:Tpr UTSW 1 150,321,639 (GRCm39) missense possibly damaging 0.93
R6550:Tpr UTSW 1 150,299,728 (GRCm39) missense probably damaging 1.00
R6592:Tpr UTSW 1 150,287,656 (GRCm39) missense possibly damaging 0.83
R6704:Tpr UTSW 1 150,282,259 (GRCm39) missense possibly damaging 0.80
R6716:Tpr UTSW 1 150,290,516 (GRCm39) missense probably damaging 1.00
R6836:Tpr UTSW 1 150,312,424 (GRCm39) splice site probably null
R6886:Tpr UTSW 1 150,299,716 (GRCm39) missense probably benign 0.00
R6894:Tpr UTSW 1 150,312,598 (GRCm39) missense probably benign 0.28
R6928:Tpr UTSW 1 150,284,536 (GRCm39) missense possibly damaging 0.83
R7011:Tpr UTSW 1 150,309,523 (GRCm39) missense probably damaging 1.00
R7034:Tpr UTSW 1 150,299,358 (GRCm39) missense probably benign 0.02
R7036:Tpr UTSW 1 150,299,358 (GRCm39) missense probably benign 0.02
R7183:Tpr UTSW 1 150,282,302 (GRCm39) missense probably damaging 1.00
R7221:Tpr UTSW 1 150,321,929 (GRCm39) missense possibly damaging 0.96
R7223:Tpr UTSW 1 150,315,007 (GRCm39) missense possibly damaging 0.53
R7294:Tpr UTSW 1 150,279,638 (GRCm39) missense probably damaging 1.00
R7343:Tpr UTSW 1 150,269,245 (GRCm39) missense unknown
R7361:Tpr UTSW 1 150,323,372 (GRCm39) missense possibly damaging 0.73
R7405:Tpr UTSW 1 150,317,878 (GRCm39) missense probably benign 0.02
R7637:Tpr UTSW 1 150,299,267 (GRCm39) missense probably damaging 1.00
R7720:Tpr UTSW 1 150,305,283 (GRCm39) missense possibly damaging 0.49
R7721:Tpr UTSW 1 150,320,180 (GRCm39) missense probably benign
R7751:Tpr UTSW 1 150,295,646 (GRCm39) missense probably benign 0.17
R7804:Tpr UTSW 1 150,308,310 (GRCm39) missense probably damaging 0.99
R7878:Tpr UTSW 1 150,299,411 (GRCm39) missense possibly damaging 0.67
R7973:Tpr UTSW 1 150,279,638 (GRCm39) missense probably damaging 1.00
R8013:Tpr UTSW 1 150,274,359 (GRCm39) missense probably benign
R8220:Tpr UTSW 1 150,308,164 (GRCm39) missense probably benign 0.05
R8274:Tpr UTSW 1 150,299,230 (GRCm39) splice site probably benign
R8428:Tpr UTSW 1 150,290,564 (GRCm39) missense probably damaging 1.00
R8482:Tpr UTSW 1 150,309,451 (GRCm39) missense probably damaging 1.00
R8699:Tpr UTSW 1 150,293,772 (GRCm39) missense probably damaging 0.99
R9119:Tpr UTSW 1 150,279,753 (GRCm39) missense probably damaging 0.99
R9326:Tpr UTSW 1 150,301,407 (GRCm39) missense possibly damaging 0.86
R9618:Tpr UTSW 1 150,321,979 (GRCm39) missense possibly damaging 0.70
R9680:Tpr UTSW 1 150,314,887 (GRCm39) missense probably benign 0.32
R9776:Tpr UTSW 1 150,324,939 (GRCm39) missense probably benign 0.00
X0021:Tpr UTSW 1 150,270,958 (GRCm39) missense probably damaging 1.00
Z1177:Tpr UTSW 1 150,303,986 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTAGAGCCAGGCTTTGAGTG -3'
(R):5'- GCTGCAAGCTCTTCTTCAGAC -3'

Sequencing Primer
(F):5'- AGCCTCTAGGATTTAATGTCTCCAG -3'
(R):5'- TCGAGCAGCTCAAGGAAT -3'
Posted On 2021-07-15