Incidental Mutation 'R8859:Tpr'
ID 675497
Institutional Source Beutler Lab
Gene Symbol Tpr
Ensembl Gene ENSMUSG00000006005
Gene Name translocated promoter region, nuclear basket protein
Synonyms 2610029M07Rik
Accession Numbers

Genbank: NM_133780; MGI: 1922066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8859 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 150392838-150449935 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 150408846 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 428 (E428G)
Ref Sequence ENSEMBL: ENSMUSP00000117616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124973]
AlphaFold F6ZDS4
Predicted Effect possibly damaging
Transcript: ENSMUST00000119161
AA Change: E354G

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: E354G

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124973
AA Change: E428G

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: E428G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,378,397 Y3490F Het
Abcc1 T C 16: 14,396,361 V167A probably benign Het
Abcd2 G A 15: 91,188,946 R337C probably damaging Het
Adcy1 A G 11: 7,161,877 D914G probably benign Het
Ahnak G T 19: 9,007,203 L1950F probably damaging Het
Alox5ap T C 5: 149,265,184 probably null Het
Ank C T 15: 27,562,748 H181Y possibly damaging Het
Ankrd44 T A 1: 54,667,521 D592V possibly damaging Het
Ap4m1 T A 5: 138,175,923 N185K possibly damaging Het
Arhgef28 T A 13: 97,945,702 D1199V probably damaging Het
Arnt T C 3: 95,490,380 probably null Het
Atcay C T 10: 81,224,464 V13M probably benign Het
B4galt3 T C 1: 171,271,671 S2P unknown Het
Bicra A T 7: 15,987,812 S593R possibly damaging Het
Brsk2 A C 7: 141,998,678 Q633P probably damaging Het
Cacna1c T A 6: 118,676,319 S909C Het
Ccdc7a G A 8: 129,061,632 T72M probably benign Het
Cct2 A T 10: 117,060,834 F155I possibly damaging Het
Cdv3 G T 9: 103,356,395 P194T probably damaging Het
Cenpc1 A T 5: 86,012,294 V895E probably benign Het
Cep170b T C 12: 112,736,447 V448A probably benign Het
Chil3 G A 3: 106,164,124 R75C possibly damaging Het
Cnfn A T 7: 25,368,444 C24S probably benign Het
Cnga3 A G 1: 37,260,771 K191E possibly damaging Het
Col12a1 A T 9: 79,680,399 Y1153* probably null Het
Coq4 C A 2: 29,795,479 H168Q probably damaging Het
Cyr61 T C 3: 145,648,625 D177G probably benign Het
Dnajc14 G A 10: 128,806,619 V137I probably benign Het
Efr3a T C 15: 65,854,765 L569P probably damaging Het
Epb41l3 A T 17: 69,284,580 E677D probably benign Het
Esp8 G A 17: 40,530,122 M91I unknown Het
Fubp1 A T 3: 152,232,032 probably benign Het
Gldc G T 19: 30,139,379 A391D probably damaging Het
Gm17728 A G 17: 9,422,195 T46A probably benign Het
Gm5798 A G 14: 41,350,646 K112E probably damaging Het
Gm884 A C 11: 103,615,544 I1866S unknown Het
Gpnmb A G 6: 49,052,030 probably benign Het
Grwd1 T C 7: 45,825,874 T415A probably benign Het
Gsdma3 C G 11: 98,631,260 A172G possibly damaging Het
Hltf C T 3: 20,065,402 Q204* probably null Het
Igf1r T G 7: 68,183,463 V457G possibly damaging Het
Inhbc A T 10: 127,357,115 M344K probably damaging Het
Jak3 C T 8: 71,678,516 A60V probably benign Het
Kif13b A G 14: 64,742,433 T511A probably benign Het
Lama2 T A 10: 27,459,388 N97I possibly damaging Het
Limd2 T A 11: 106,158,750 D104V probably damaging Het
Loxl3 T A 6: 83,037,545 C145S probably damaging Het
Lrrc73 A G 17: 46,254,529 N62S probably benign Het
Lrrtm4 A G 6: 80,021,887 D94G probably damaging Het
Lsm3 C A 6: 91,522,270 F86L probably damaging Het
Map10 T C 8: 125,670,552 V228A probably benign Het
Mcidas A C 13: 112,994,130 S54R possibly damaging Het
Me3 T C 7: 89,806,668 Y243H probably damaging Het
Mgat4b A G 11: 50,230,847 T89A possibly damaging Het
Mmp16 T A 4: 18,054,355 probably benign Het
Mtmr9 G A 14: 63,543,777 probably benign Het
Myo1b G T 1: 51,797,039 A331E probably damaging Het
Ncoa6 C T 2: 155,406,468 V1639M possibly damaging Het
Nek9 C T 12: 85,306,346 G752R probably damaging Het
Nufip2 A G 11: 77,693,243 Y661C probably benign Het
Olfr1490 T A 19: 13,654,882 V151E probably damaging Het
Olfr354 C T 2: 36,907,504 A186V possibly damaging Het
Olfr574 A T 7: 102,949,166 I234F probably damaging Het
Olfr828 T C 9: 18,815,696 I199M possibly damaging Het
Olfr972 G A 9: 39,873,598 G108S probably benign Het
Oxct2a A G 4: 123,322,529 L353S probably benign Het
Parvg A G 15: 84,337,800 I243V probably benign Het
Pcdhgb7 C A 18: 37,753,296 N506K possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pgghg G A 7: 140,945,454 probably null Het
Phrf1 G T 7: 141,256,603 G263W unknown Het
Ppfia1 A C 7: 144,479,025 probably null Het
Ppp1r32 T A 19: 10,482,235 Y36F probably damaging Het
Prss37 T A 6: 40,514,963 I228F probably damaging Het
Ptpro A T 6: 137,426,784 K921* probably null Het
Rictor T G 15: 6,783,586 L940R probably damaging Het
Rp1 A G 1: 4,349,960 S310P probably benign Het
Ryr3 A G 2: 112,653,219 V4091A probably damaging Het
Sirt5 T A 13: 43,370,851 M33K possibly damaging Het
Slc25a30 T A 14: 75,771,477 Y90F probably benign Het
St5 T A 7: 109,524,656 K1132M probably damaging Het
Stk11 G A 10: 80,128,435 D388N probably benign Het
Tgm1 C A 14: 55,712,229 R126L probably benign Het
Tmem110 T A 14: 30,866,672 Y119N probably damaging Het
Tmem129 G T 5: 33,654,493 T321N probably benign Het
Tnfrsf11a A T 1: 105,844,518 probably null Het
Tor1aip1 A G 1: 156,031,444 C195R probably benign Het
Trps1 T A 15: 50,822,373 D802V possibly damaging Het
Usp17lc T A 7: 103,415,109 S6T probably benign Het
Vangl1 C A 3: 102,158,442 R459L Het
Vmn1r43 T C 6: 89,869,955 Y183C probably damaging Het
Vmn2r110 C T 17: 20,574,298 C703Y probably damaging Het
Vmn2r54 T C 7: 12,629,775 Q397R possibly damaging Het
Vmn2r88 T C 14: 51,418,806 V824A probably damaging Het
Vmn2r89 A T 14: 51,455,713 Y79F probably benign Het
Vnn1 T C 10: 23,904,586 S491P probably benign Het
Zbbx A G 3: 75,061,434 F572L unknown Het
Zc3h4 A T 7: 16,435,014 Q1091L unknown Het
Zfp503 C T 14: 21,987,218 V106I possibly damaging Het
Zfp874a T C 13: 67,442,528 T346A probably benign Het
Other mutations in Tpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Tpr APN 1 150423696 splice site probably benign
IGL00424:Tpr APN 1 150398595 splice site probably benign
IGL01095:Tpr APN 1 150410140 missense possibly damaging 0.95
IGL01347:Tpr APN 1 150426987 missense probably damaging 1.00
IGL01519:Tpr APN 1 150431168 missense probably benign 0.01
IGL01768:Tpr APN 1 150444448 missense possibly damaging 0.85
IGL01939:Tpr APN 1 150413745 missense possibly damaging 0.82
IGL01988:Tpr APN 1 150426999 splice site probably null
IGL02065:Tpr APN 1 150413774 missense probably benign 0.13
IGL02110:Tpr APN 1 150435742 missense probably damaging 0.97
IGL02311:Tpr APN 1 150398653 missense probably damaging 0.97
IGL02454:Tpr APN 1 150431192 missense probably benign 0.00
IGL02569:Tpr APN 1 150425631 unclassified probably benign
IGL03168:Tpr APN 1 150408757 missense probably benign 0.04
IGL03193:Tpr APN 1 150440080 missense possibly damaging 0.85
IGL03333:Tpr APN 1 150426967 missense probably benign 0.04
gridiron UTSW 1 150423516 missense probably damaging 1.00
Pouch UTSW 1 150433772 missense probably damaging 1.00
punt UTSW 1 150418039 missense probably benign 0.02
Turf UTSW 1 150442245 critical splice donor site probably null
F6893:Tpr UTSW 1 150393562 missense possibly damaging 0.84
PIT4305001:Tpr UTSW 1 150440137 missense possibly damaging 0.85
PIT4469001:Tpr UTSW 1 150403956 missense probably benign 0.41
R0085:Tpr UTSW 1 150417413 missense possibly damaging 0.95
R0101:Tpr UTSW 1 150409302 splice site probably benign
R0116:Tpr UTSW 1 150410147 missense probably damaging 0.98
R0136:Tpr UTSW 1 150430595 missense probably benign 0.01
R0207:Tpr UTSW 1 150417427 missense possibly damaging 0.74
R0219:Tpr UTSW 1 150443258 splice site probably null
R0380:Tpr UTSW 1 150412947 missense probably benign 0.27
R0403:Tpr UTSW 1 150407414 splice site probably benign
R0469:Tpr UTSW 1 150423667 frame shift probably null
R0480:Tpr UTSW 1 150428241 missense possibly damaging 0.83
R0514:Tpr UTSW 1 150402273 missense possibly damaging 0.55
R0563:Tpr UTSW 1 150408858 missense probably benign 0.13
R0631:Tpr UTSW 1 150422531 missense probably damaging 0.98
R0685:Tpr UTSW 1 150433725 missense possibly damaging 0.69
R0730:Tpr UTSW 1 150393407 utr 5 prime probably benign
R0739:Tpr UTSW 1 150407497 missense possibly damaging 0.94
R0780:Tpr UTSW 1 150431341 missense probably benign 0.00
R1018:Tpr UTSW 1 150442183 missense possibly damaging 0.53
R1084:Tpr UTSW 1 150442161 missense probably benign 0.18
R1532:Tpr UTSW 1 150418000 missense probably damaging 0.99
R1551:Tpr UTSW 1 150436801 missense probably benign 0.00
R1608:Tpr UTSW 1 150426893 missense probably damaging 0.96
R1759:Tpr UTSW 1 150429524 missense probably benign 0.19
R1817:Tpr UTSW 1 150419903 missense probably damaging 0.98
R1932:Tpr UTSW 1 150421663 missense probably benign 0.00
R1978:Tpr UTSW 1 150419907 missense possibly damaging 0.65
R2031:Tpr UTSW 1 150442119 missense probably benign
R2176:Tpr UTSW 1 150419940 missense possibly damaging 0.56
R2235:Tpr UTSW 1 150442092 missense probably benign 0.33
R2339:Tpr UTSW 1 150413774 missense probably benign 0.01
R2367:Tpr UTSW 1 150433728 missense probably damaging 0.99
R2507:Tpr UTSW 1 150392944 start codon destroyed probably null
R3931:Tpr UTSW 1 150435904 missense probably damaging 1.00
R4320:Tpr UTSW 1 150423574 missense possibly damaging 0.96
R4439:Tpr UTSW 1 150403961 missense probably benign 0.01
R4568:Tpr UTSW 1 150392959 unclassified probably benign
R4644:Tpr UTSW 1 150423499 missense probably benign 0.01
R4665:Tpr UTSW 1 150444399 missense probably damaging 0.97
R4672:Tpr UTSW 1 150423567 missense probably benign 0.45
R4673:Tpr UTSW 1 150423567 missense probably benign 0.45
R4735:Tpr UTSW 1 150442196 missense possibly damaging 0.91
R4767:Tpr UTSW 1 150430529 intron probably benign
R4772:Tpr UTSW 1 150413113 missense possibly damaging 0.46
R4815:Tpr UTSW 1 150398608 missense probably benign 0.01
R4839:Tpr UTSW 1 150449197 nonsense probably null
R4844:Tpr UTSW 1 150445879 missense possibly damaging 0.86
R4925:Tpr UTSW 1 150432565 missense probably benign 0.00
R4967:Tpr UTSW 1 150410059 missense probably damaging 0.99
R5017:Tpr UTSW 1 150398637 missense probably benign 0.00
R5096:Tpr UTSW 1 150446202 missense probably damaging 0.99
R5353:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5354:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5484:Tpr UTSW 1 150426888 missense probably benign 0.33
R5601:Tpr UTSW 1 150435853 missense possibly damaging 0.75
R5642:Tpr UTSW 1 150423818 missense probably damaging 0.99
R5779:Tpr UTSW 1 150423541 missense probably damaging 1.00
R5787:Tpr UTSW 1 150395286 missense probably benign 0.01
R5892:Tpr UTSW 1 150407400 missense probably benign 0.44
R5915:Tpr UTSW 1 150425649 missense probably benign 0.15
R5928:Tpr UTSW 1 150428127 missense probably benign 0.30
R6146:Tpr UTSW 1 150423162 missense possibly damaging 0.83
R6154:Tpr UTSW 1 150423816 missense probably benign 0.00
R6234:Tpr UTSW 1 150418039 missense probably benign 0.02
R6263:Tpr UTSW 1 150442245 critical splice donor site probably null
R6318:Tpr UTSW 1 150445888 missense possibly damaging 0.93
R6550:Tpr UTSW 1 150423977 missense probably damaging 1.00
R6592:Tpr UTSW 1 150411905 missense possibly damaging 0.83
R6704:Tpr UTSW 1 150406508 missense possibly damaging 0.80
R6716:Tpr UTSW 1 150414765 missense probably damaging 1.00
R6836:Tpr UTSW 1 150436673 splice site probably null
R6886:Tpr UTSW 1 150423965 missense probably benign 0.00
R6894:Tpr UTSW 1 150436847 missense probably benign 0.28
R6928:Tpr UTSW 1 150408785 missense possibly damaging 0.83
R7011:Tpr UTSW 1 150433772 missense probably damaging 1.00
R7034:Tpr UTSW 1 150423607 missense probably benign 0.02
R7036:Tpr UTSW 1 150423607 missense probably benign 0.02
R7183:Tpr UTSW 1 150406551 missense probably damaging 1.00
R7221:Tpr UTSW 1 150446178 missense possibly damaging 0.96
R7223:Tpr UTSW 1 150439256 missense possibly damaging 0.53
R7294:Tpr UTSW 1 150403887 missense probably damaging 1.00
R7343:Tpr UTSW 1 150393494 missense unknown
R7361:Tpr UTSW 1 150447621 missense possibly damaging 0.73
R7405:Tpr UTSW 1 150442127 missense probably benign 0.02
R7637:Tpr UTSW 1 150423516 missense probably damaging 1.00
R7720:Tpr UTSW 1 150429532 missense possibly damaging 0.49
R7721:Tpr UTSW 1 150444429 missense probably benign
R7751:Tpr UTSW 1 150419895 missense probably benign 0.17
R7804:Tpr UTSW 1 150432559 missense probably damaging 0.99
R7878:Tpr UTSW 1 150423660 missense possibly damaging 0.67
R7973:Tpr UTSW 1 150403887 missense probably damaging 1.00
R8013:Tpr UTSW 1 150398608 missense probably benign
R8220:Tpr UTSW 1 150432413 missense probably benign 0.05
R8274:Tpr UTSW 1 150423479 splice site probably benign
R8428:Tpr UTSW 1 150414813 missense probably damaging 1.00
R8482:Tpr UTSW 1 150433700 missense probably damaging 1.00
R8699:Tpr UTSW 1 150418021 missense probably damaging 0.99
R9119:Tpr UTSW 1 150404002 missense probably damaging 0.99
R9326:Tpr UTSW 1 150425656 missense possibly damaging 0.86
X0021:Tpr UTSW 1 150395207 missense probably damaging 1.00
Z1177:Tpr UTSW 1 150428235 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTAGAGCCAGGCTTTGAGTG -3'
(R):5'- GCTGCAAGCTCTTCTTCAGAC -3'

Sequencing Primer
(F):5'- AGCCTCTAGGATTTAATGTCTCCAG -3'
(R):5'- TCGAGCAGCTCAAGGAAT -3'
Posted On 2021-07-15