Mutagenetix > Incidental Mutation

Incidental Mutation 'R8859:Ryr3'

675502

Institutional Source

Beutler Lab

Gene Symbol

Ryr3

Ensembl Gene

ENSMUSG00000057378

Gene Name

ryanodine receptor 3

Synonyms

calcium release channel isoform 3

MMRRC Submission

Accession Numbers

Genbank: NM_177652.2

Essential gene?

Possibly non essential (E-score: 0.363) question?

Stock #

R8859 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

112631355-113217096 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 112653219 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 4091 (V4091A)

Ref Sequence

ENSEMBL: ENSMUSP00000089426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080673] [ENSMUST00000091818] [ENSMUST00000134358] [ENSMUST00000208151] [ENSMUST00000208290]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000080673
AA Change: V4066A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000079503
Gene: ENSMUSG00000057378
AA Change: V4066A

Domain	Start	End	E-Value	Type
low complexity region	90	99	N/A	INTRINSIC
MIR	100	155	3.27e-4	SMART
MIR	162	207	7.52e-4	SMART
MIR	215	269	8.06e-4	SMART
MIR	275	368	8.4e-25	SMART
Pfam:RYDR_ITPR	438	642	1.1e-71	PFAM
SPRY	657	795	1.16e-24	SMART
Pfam:RyR	848	942	1.5e-34	PFAM
Pfam:RyR	962	1056	1.2e-32	PFAM
SPRY	1084	1207	7.99e-37	SMART
SPRY	1325	1465	6.25e-30	SMART
low complexity region	1757	1772	N/A	INTRINSIC
low complexity region	1773	1788	N/A	INTRINSIC
low complexity region	1932	1957	N/A	INTRINSIC
Pfam:RYDR_ITPR	2018	2228	1.8e-59	PFAM
Pfam:RyR	2595	2689	1.2e-36	PFAM
Pfam:RyR	2713	2801	2.1e-31	PFAM
low complexity region	2877	2887	N/A	INTRINSIC
low complexity region	3169	3184	N/A	INTRINSIC
low complexity region	3327	3338	N/A	INTRINSIC
PDB:2BCX\|B	3462	3491	9e-12	PDB
low complexity region	3532	3540	N/A	INTRINSIC
coiled coil region	3585	3614	N/A	INTRINSIC
Pfam:RIH_assoc	3715	3848	4.9e-40	PFAM
low complexity region	3855	3875	N/A	INTRINSIC
SCOP:d1sra__	3893	3989	1e-10	SMART
low complexity region	4096	4134	N/A	INTRINSIC
transmembrane domain	4178	4200	N/A	INTRINSIC
Pfam:RR_TM4-6	4227	4497	4.7e-96	PFAM
Pfam:Ion_trans	4599	4762	2e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000091818
AA Change: V4091A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000089426
Gene: ENSMUSG00000057378
AA Change: V4091A

Domain	Start	End	E-Value	Type
low complexity region	110	119	N/A	INTRINSIC
MIR	120	175	3.27e-4	SMART
MIR	182	227	7.52e-4	SMART
MIR	235	289	8.06e-4	SMART
MIR	295	388	8.4e-25	SMART
Pfam:RYDR_ITPR	460	655	1.2e-64	PFAM
SPRY	677	815	1.16e-24	SMART
Pfam:RyR	869	959	3.3e-38	PFAM
Pfam:RyR	983	1073	2.5e-32	PFAM
SPRY	1104	1227	7.99e-37	SMART
SPRY	1345	1485	6.25e-30	SMART
low complexity region	1777	1792	N/A	INTRINSIC
low complexity region	1793	1808	N/A	INTRINSIC
low complexity region	1952	1977	N/A	INTRINSIC
Pfam:RYDR_ITPR	2040	2248	5.8e-67	PFAM
Pfam:RyR	2616	2706	6.3e-33	PFAM
Pfam:RyR	2734	2818	6.6e-26	PFAM
low complexity region	2897	2907	N/A	INTRINSIC
low complexity region	3189	3204	N/A	INTRINSIC
PDB:2BCX\|B	3487	3516	1e-11	PDB
low complexity region	3557	3565	N/A	INTRINSIC
coiled coil region	3610	3639	N/A	INTRINSIC
Pfam:RIH_assoc	3744	3862	3.5e-34	PFAM
low complexity region	3880	3900	N/A	INTRINSIC
SCOP:d1sra__	3918	4014	1e-10	SMART
low complexity region	4121	4159	N/A	INTRINSIC
transmembrane domain	4203	4225	N/A	INTRINSIC
Pfam:RR_TM4-6	4252	4522	1.1e-98	PFAM
Pfam:Ion_trans	4625	4799	6.2e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000134358
AA Change: V4061A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208151
AA Change: V4066A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208290
AA Change: V4071A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

99% (95/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ryanodine receptor, which functions to release calcium from intracellular storage for use in many cellular processes. For example, the encoded protein is involved in skeletal muscle contraction by releasing calcium from the sarcoplasmic reticulum followed by depolarization of T-tubules. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired muscle contraction at an early age, changes in hippocampal synaptic plasticity, increased locomotor activity with a tendency to circle, and impaired relearning of a spatial task. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted, knock-out(5) Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,378,397	Y3490F		Het
Abcc1	T	C	16: 14,396,361	V167A	probably benign	Het
Abcd2	G	A	15: 91,188,946	R337C	probably damaging	Het
Adcy1	A	G	11: 7,161,877	D914G	probably benign	Het
Ahnak	G	T	19: 9,007,203	L1950F	probably damaging	Het
Alox5ap	T	C	5: 149,265,184		probably null	Het
Ank	C	T	15: 27,562,748	H181Y	possibly damaging	Het
Ankrd44	T	A	1: 54,667,521	D592V	possibly damaging	Het
Ap4m1	T	A	5: 138,175,923	N185K	possibly damaging	Het
Arhgef28	T	A	13: 97,945,702	D1199V	probably damaging	Het
Arnt	T	C	3: 95,490,380		probably null	Het
Atcay	C	T	10: 81,224,464	V13M	probably benign	Het
B4galt3	T	C	1: 171,271,671	S2P	unknown	Het
Bicra	A	T	7: 15,987,812	S593R	possibly damaging	Het
Brsk2	A	C	7: 141,998,678	Q633P	probably damaging	Het
Cacna1c	T	A	6: 118,676,319	S909C		Het
Ccdc7a	G	A	8: 129,061,632	T72M	probably benign	Het
Cct2	A	T	10: 117,060,834	F155I	possibly damaging	Het
Cdv3	G	T	9: 103,356,395	P194T	probably damaging	Het
Cenpc1	A	T	5: 86,012,294	V895E	probably benign	Het
Cep170b	T	C	12: 112,736,447	V448A	probably benign	Het
Chil3	G	A	3: 106,164,124	R75C	possibly damaging	Het
Cnfn	A	T	7: 25,368,444	C24S	probably benign	Het
Cnga3	A	G	1: 37,260,771	K191E	possibly damaging	Het
Col12a1	A	T	9: 79,680,399	Y1153*	probably null	Het
Coq4	C	A	2: 29,795,479	H168Q	probably damaging	Het
Cyr61	T	C	3: 145,648,625	D177G	probably benign	Het
Dnajc14	G	A	10: 128,806,619	V137I	probably benign	Het
Efr3a	T	C	15: 65,854,765	L569P	probably damaging	Het
Epb41l3	A	T	17: 69,284,580	E677D	probably benign	Het
Esp8	G	A	17: 40,530,122	M91I	unknown	Het
Fubp1	A	T	3: 152,232,032		probably benign	Het
Gldc	G	T	19: 30,139,379	A391D	probably damaging	Het
Gm17728	A	G	17: 9,422,195	T46A	probably benign	Het
Gm5798	A	G	14: 41,350,646	K112E	probably damaging	Het
Gm884	A	C	11: 103,615,544	I1866S	unknown	Het
Gpnmb	A	G	6: 49,052,030		probably benign	Het
Grwd1	T	C	7: 45,825,874	T415A	probably benign	Het
Gsdma3	C	G	11: 98,631,260	A172G	possibly damaging	Het
Hltf	C	T	3: 20,065,402	Q204*	probably null	Het
Igf1r	T	G	7: 68,183,463	V457G	possibly damaging	Het
Inhbc	A	T	10: 127,357,115	M344K	probably damaging	Het
Jak3	C	T	8: 71,678,516	A60V	probably benign	Het
Kif13b	A	G	14: 64,742,433	T511A	probably benign	Het
Lama2	T	A	10: 27,459,388	N97I	possibly damaging	Het
Limd2	T	A	11: 106,158,750	D104V	probably damaging	Het
Loxl3	T	A	6: 83,037,545	C145S	probably damaging	Het
Lrrc73	A	G	17: 46,254,529	N62S	probably benign	Het
Lrrtm4	A	G	6: 80,021,887	D94G	probably damaging	Het
Lsm3	C	A	6: 91,522,270	F86L	probably damaging	Het
Map10	T	C	8: 125,670,552	V228A	probably benign	Het
Mcidas	A	C	13: 112,994,130	S54R	possibly damaging	Het
Me3	T	C	7: 89,806,668	Y243H	probably damaging	Het
Mgat4b	A	G	11: 50,230,847	T89A	possibly damaging	Het
Mmp16	T	A	4: 18,054,355		probably benign	Het
Mtmr9	G	A	14: 63,543,777		probably benign	Het
Myo1b	G	T	1: 51,797,039	A331E	probably damaging	Het
Ncoa6	C	T	2: 155,406,468	V1639M	possibly damaging	Het
Nek9	C	T	12: 85,306,346	G752R	probably damaging	Het
Nufip2	A	G	11: 77,693,243	Y661C	probably benign	Het
Olfr1490	T	A	19: 13,654,882	V151E	probably damaging	Het
Olfr354	C	T	2: 36,907,504	A186V	possibly damaging	Het
Olfr574	A	T	7: 102,949,166	I234F	probably damaging	Het
Olfr828	T	C	9: 18,815,696	I199M	possibly damaging	Het
Olfr972	G	A	9: 39,873,598	G108S	probably benign	Het
Oxct2a	A	G	4: 123,322,529	L353S	probably benign	Het
Parvg	A	G	15: 84,337,800	I243V	probably benign	Het
Pcdhgb7	C	A	18: 37,753,296	N506K	possibly damaging	Het
Peg10	T	TCCA	6: 4,756,451		probably benign	Het
Pgghg	G	A	7: 140,945,454		probably null	Het
Phrf1	G	T	7: 141,256,603	G263W	unknown	Het
Ppfia1	A	C	7: 144,479,025		probably null	Het
Ppp1r32	T	A	19: 10,482,235	Y36F	probably damaging	Het
Prss37	T	A	6: 40,514,963	I228F	probably damaging	Het
Ptpro	A	T	6: 137,426,784	K921*	probably null	Het
Rictor	T	G	15: 6,783,586	L940R	probably damaging	Het
Rp1	A	G	1: 4,349,960	S310P	probably benign	Het
Sirt5	T	A	13: 43,370,851	M33K	possibly damaging	Het
Slc25a30	T	A	14: 75,771,477	Y90F	probably benign	Het
St5	T	A	7: 109,524,656	K1132M	probably damaging	Het
Stk11	G	A	10: 80,128,435	D388N	probably benign	Het
Tgm1	C	A	14: 55,712,229	R126L	probably benign	Het
Tmem110	T	A	14: 30,866,672	Y119N	probably damaging	Het
Tmem129	G	T	5: 33,654,493	T321N	probably benign	Het
Tnfrsf11a	A	T	1: 105,844,518		probably null	Het
Tor1aip1	A	G	1: 156,031,444	C195R	probably benign	Het
Tpr	A	G	1: 150,408,846	E428G	possibly damaging	Het
Trps1	T	A	15: 50,822,373	D802V	possibly damaging	Het
Usp17lc	T	A	7: 103,415,109	S6T	probably benign	Het
Vangl1	C	A	3: 102,158,442	R459L		Het
Vmn1r43	T	C	6: 89,869,955	Y183C	probably damaging	Het
Vmn2r110	C	T	17: 20,574,298	C703Y	probably damaging	Het
Vmn2r54	T	C	7: 12,629,775	Q397R	possibly damaging	Het
Vmn2r88	T	C	14: 51,418,806	V824A	probably damaging	Het
Vmn2r89	A	T	14: 51,455,713	Y79F	probably benign	Het
Vnn1	T	C	10: 23,904,586	S491P	probably benign	Het
Zbbx	A	G	3: 75,061,434	F572L	unknown	Het
Zc3h4	A	T	7: 16,435,014	Q1091L	unknown	Het
Zfp503	C	T	14: 21,987,218	V106I	possibly damaging	Het
Zfp874a	T	C	13: 67,442,528	T346A	probably benign	Het

Other mutations in Ryr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Ryr3	APN	2	112660149	missense	probably damaging	0.98
IGL00531:Ryr3	APN	2	112663012	splice site	probably benign
IGL00785:Ryr3	APN	2	112836103	missense	possibly damaging	0.95
IGL00901:Ryr3	APN	2	112886589	missense	probably damaging	1.00
IGL00910:Ryr3	APN	2	112728934	splice site	probably benign
IGL00970:Ryr3	APN	2	112764676	missense	probably damaging	1.00
IGL01083:Ryr3	APN	2	112751846	splice site	probably benign
IGL01105:Ryr3	APN	2	112751805	missense	probably damaging	1.00
IGL01287:Ryr3	APN	2	112709073	missense	probably damaging	1.00
IGL01343:Ryr3	APN	2	112660054	missense	probably damaging	1.00
IGL01472:Ryr3	APN	2	112672248	missense	probably benign	0.20
IGL01552:Ryr3	APN	2	112825883	missense	possibly damaging	0.53
IGL01594:Ryr3	APN	2	112772728	missense	probably damaging	1.00
IGL01723:Ryr3	APN	2	112650111	critical splice donor site	probably null
IGL01837:Ryr3	APN	2	112801320	missense	probably damaging	1.00
IGL01868:Ryr3	APN	2	112803158	splice site	probably benign
IGL01907:Ryr3	APN	2	112869001	splice site	probably benign
IGL02005:Ryr3	APN	2	112663263	splice site	probably benign
IGL02014:Ryr3	APN	2	112946915	missense	possibly damaging	0.86
IGL02109:Ryr3	APN	2	112949157	missense	probably benign
IGL02178:Ryr3	APN	2	112825799	missense	probably benign	0.17
IGL02185:Ryr3	APN	2	112967203	missense	probably damaging	0.99
IGL02189:Ryr3	APN	2	112754838	splice site	probably benign
IGL02200:Ryr3	APN	2	112849510	missense	probably damaging	0.98
IGL02302:Ryr3	APN	2	112964356	missense	probably damaging	1.00
IGL02305:Ryr3	APN	2	112645277	missense	probably damaging	0.96
IGL02306:Ryr3	APN	2	112834114	missense	probably damaging	0.98
IGL02306:Ryr3	APN	2	112847399	critical splice donor site	probably null
IGL02340:Ryr3	APN	2	112947004	splice site	probably benign
IGL02398:Ryr3	APN	2	112847422	missense	probably benign	0.05
IGL02407:Ryr3	APN	2	112754958	missense	probably damaging	1.00
IGL02426:Ryr3	APN	2	112900905	missense	possibly damaging	0.59
IGL02452:Ryr3	APN	2	112833990	missense	probably damaging	1.00
IGL02453:Ryr3	APN	2	112681728	splice site	probably benign
IGL02585:Ryr3	APN	2	112712303	missense	probably damaging	1.00
IGL02724:Ryr3	APN	2	112902576	critical splice donor site	probably null
IGL02817:Ryr3	APN	2	112844623	critical splice donor site	probably null
IGL02861:Ryr3	APN	2	112652841	missense	possibly damaging	0.89
IGL03038:Ryr3	APN	2	112668120	missense	possibly damaging	0.83
IGL03059:Ryr3	APN	2	112800047	missense	probably damaging	1.00
IGL03136:Ryr3	APN	2	112675974	splice site	probably benign
IGL03137:Ryr3	APN	2	112910397	missense	probably benign
IGL03166:Ryr3	APN	2	112641112	nonsense	probably null
IGL03177:Ryr3	APN	2	113028671	missense	probably benign	0.39
IGL03205:Ryr3	APN	2	112632142	missense	probably damaging	1.00
IGL03224:Ryr3	APN	2	112954336	nonsense	probably null
IGL03249:Ryr3	APN	2	112640656	missense	probably benign	0.32
IGL03370:Ryr3	APN	2	112756599	missense	possibly damaging	0.69
intruder	UTSW	2	112672246	nonsense	probably null
usurper	UTSW	2	112800022	missense	probably damaging	1.00
ANU74:Ryr3	UTSW	2	112831230	critical splice acceptor site	probably null
BB006:Ryr3	UTSW	2	112834188	missense	probably benign	0.00
BB016:Ryr3	UTSW	2	112834188	missense	probably benign	0.00
F5426:Ryr3	UTSW	2	112766338	splice site	probably benign
PIT4494001:Ryr3	UTSW	2	112841876	missense	probably damaging	0.99
R0022:Ryr3	UTSW	2	112640666	missense	probably damaging	1.00
R0022:Ryr3	UTSW	2	112640666	missense	probably damaging	1.00
R0051:Ryr3	UTSW	2	112869075	missense	probably damaging	1.00
R0051:Ryr3	UTSW	2	112869075	missense	probably damaging	1.00
R0085:Ryr3	UTSW	2	112859763	missense	probably damaging	1.00
R0097:Ryr3	UTSW	2	112800055	missense	probably damaging	1.00
R0097:Ryr3	UTSW	2	112800055	missense	probably damaging	1.00
R0098:Ryr3	UTSW	2	112901031	missense	probably damaging	1.00
R0098:Ryr3	UTSW	2	112901031	missense	probably damaging	1.00
R0116:Ryr3	UTSW	2	112803165	missense	probably damaging	0.99
R0281:Ryr3	UTSW	2	112686810	missense	probably damaging	1.00
R0302:Ryr3	UTSW	2	112647123	splice site	probably benign
R0306:Ryr3	UTSW	2	112775655	critical splice donor site	probably null
R0445:Ryr3	UTSW	2	112866054	missense	probably benign	0.16
R0463:Ryr3	UTSW	2	112661701	missense	probably damaging	1.00
R0592:Ryr3	UTSW	2	112678481	missense	probably damaging	1.00
R0622:Ryr3	UTSW	2	112662555	missense	probably damaging	1.00
R0656:Ryr3	UTSW	2	112648306	splice site	probably benign
R0735:Ryr3	UTSW	2	112732982	missense	probably benign	0.11
R0783:Ryr3	UTSW	2	112756327	splice site	probably benign
R0789:Ryr3	UTSW	2	112780973	splice site	probably null
R0835:Ryr3	UTSW	2	112650138	missense	probably benign	0.16
R0879:Ryr3	UTSW	2	113030243	missense	probably benign	0.02
R0924:Ryr3	UTSW	2	112841833	missense	probably damaging	1.00
R0930:Ryr3	UTSW	2	112841833	missense	probably damaging	1.00
R0931:Ryr3	UTSW	2	112653702	missense	probably damaging	1.00
R1037:Ryr3	UTSW	2	112869108	missense	probably benign	0.42
R1169:Ryr3	UTSW	2	112733014	missense	probably benign	0.01
R1170:Ryr3	UTSW	2	112946987	missense	probably damaging	1.00
R1178:Ryr3	UTSW	2	112964380	missense	probably benign	0.00
R1187:Ryr3	UTSW	2	112958176	missense	probably damaging	1.00
R1289:Ryr3	UTSW	2	112645285	missense	probably damaging	1.00
R1337:Ryr3	UTSW	2	112779963	missense	possibly damaging	0.46
R1342:Ryr3	UTSW	2	112750803	missense	probably damaging	1.00
R1349:Ryr3	UTSW	2	112834201	missense	probably damaging	1.00
R1372:Ryr3	UTSW	2	112834201	missense	probably damaging	1.00
R1434:Ryr3	UTSW	2	112645259	missense	probably damaging	1.00
R1438:Ryr3	UTSW	2	112757701	missense	probably benign	0.18
R1467:Ryr3	UTSW	2	112753002	splice site	probably benign
R1470:Ryr3	UTSW	2	112653007	missense	probably benign
R1470:Ryr3	UTSW	2	112653007	missense	probably benign
R1474:Ryr3	UTSW	2	112909962	missense	probably damaging	1.00
R1481:Ryr3	UTSW	2	112636522	splice site	probably benign
R1513:Ryr3	UTSW	2	112709197	nonsense	probably null
R1524:Ryr3	UTSW	2	112869082	missense	probably damaging	0.98
R1525:Ryr3	UTSW	2	112678090	missense	probably damaging	1.00
R1526:Ryr3	UTSW	2	112661657	missense	probably damaging	1.00
R1611:Ryr3	UTSW	2	112653505	missense	possibly damaging	0.72
R1640:Ryr3	UTSW	2	112900833	missense	probably damaging	1.00
R1662:Ryr3	UTSW	2	112709273	missense	probably damaging	0.99
R1764:Ryr3	UTSW	2	112860460	missense	probably damaging	1.00
R1769:Ryr3	UTSW	2	112751768	critical splice donor site	probably null
R1776:Ryr3	UTSW	2	112957253	missense	probably damaging	0.99
R1780:Ryr3	UTSW	2	112867292	missense	probably damaging	0.98
R1840:Ryr3	UTSW	2	112750820	missense	probably damaging	1.00
R1864:Ryr3	UTSW	2	112730328	missense	possibly damaging	0.65
R1872:Ryr3	UTSW	2	112709137	missense	possibly damaging	0.94
R1960:Ryr3	UTSW	2	112794467	missense	probably damaging	1.00
R1994:Ryr3	UTSW	2	112654492	missense	probably null	0.93
R2018:Ryr3	UTSW	2	112781065	missense	probably benign	0.24
R2019:Ryr3	UTSW	2	112781065	missense	probably benign	0.24
R2029:Ryr3	UTSW	2	112647016	missense	possibly damaging	0.82
R2051:Ryr3	UTSW	2	112756641	missense	probably damaging	1.00
R2060:Ryr3	UTSW	2	112954364	missense	possibly damaging	0.92
R2061:Ryr3	UTSW	2	112663004	missense	possibly damaging	0.83
R2067:Ryr3	UTSW	2	112946957	missense	probably damaging	1.00
R2106:Ryr3	UTSW	2	112638129	missense	probably damaging	1.00
R2129:Ryr3	UTSW	2	112678370	splice site	probably benign
R2140:Ryr3	UTSW	2	112875148	missense	probably benign	0.01
R2176:Ryr3	UTSW	2	112666335	missense	possibly damaging	0.48
R2241:Ryr3	UTSW	2	112801392	missense	probably damaging	1.00
R2261:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R2262:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R2276:Ryr3	UTSW	2	112649319	missense	possibly damaging	0.79
R2279:Ryr3	UTSW	2	112649319	missense	possibly damaging	0.79
R2403:Ryr3	UTSW	2	112686628	missense	probably damaging	1.00
R2510:Ryr3	UTSW	2	112675904	missense	probably benign	0.18
R2568:Ryr3	UTSW	2	112675874	missense	probably damaging	1.00
R3013:Ryr3	UTSW	2	112640281	missense	probably damaging	1.00
R3431:Ryr3	UTSW	2	112656531	missense	probably damaging	1.00
R3552:Ryr3	UTSW	2	112751787	missense	probably damaging	1.00
R3761:Ryr3	UTSW	2	112754913	missense	probably benign
R3909:Ryr3	UTSW	2	112636608	missense	probably damaging	1.00
R3923:Ryr3	UTSW	2	112841873	missense	possibly damaging	0.92
R3924:Ryr3	UTSW	2	113028703	splice site	probably benign
R3927:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R3947:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R3949:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R3976:Ryr3	UTSW	2	112675837	missense	possibly damaging	0.49
R4004:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4022:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4084:Ryr3	UTSW	2	112900908	missense	probably damaging	0.99
R4106:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4108:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4109:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4131:Ryr3	UTSW	2	112926983	splice site	probably null
R4156:Ryr3	UTSW	2	112653675	missense	probably damaging	1.00
R4172:Ryr3	UTSW	2	112794470	missense	probably damaging	1.00
R4234:Ryr3	UTSW	2	112910407	missense	probably damaging	1.00
R4399:Ryr3	UTSW	2	112946844	missense	probably benign	0.01
R4409:Ryr3	UTSW	2	112730308	missense	probably damaging	1.00
R4418:Ryr3	UTSW	2	112831224	missense	probably damaging	1.00
R4466:Ryr3	UTSW	2	112653102	missense	possibly damaging	0.92
R4525:Ryr3	UTSW	2	112653621	missense	probably damaging	0.98
R4573:Ryr3	UTSW	2	112755174	splice site	probably null
R4589:Ryr3	UTSW	2	112875133	missense	probably damaging	1.00
R4653:Ryr3	UTSW	2	112652763	missense	probably damaging	1.00
R4664:Ryr3	UTSW	2	112996555	intron	probably benign
R4710:Ryr3	UTSW	2	112766301	missense	probably damaging	1.00
R4734:Ryr3	UTSW	2	112910502	missense	probably damaging	0.99
R4741:Ryr3	UTSW	2	112803268	missense	probably damaging	0.99
R4748:Ryr3	UTSW	2	112964405	missense	possibly damaging	0.95
R4749:Ryr3	UTSW	2	112964405	missense	possibly damaging	0.95
R4754:Ryr3	UTSW	2	112757639	missense	possibly damaging	0.94
R4764:Ryr3	UTSW	2	112733031	critical splice acceptor site	probably null
R4812:Ryr3	UTSW	2	112912236	missense	probably damaging	1.00
R4822:Ryr3	UTSW	2	112652745	missense	probably damaging	1.00
R4841:Ryr3	UTSW	2	112648373	missense	probably damaging	1.00
R4849:Ryr3	UTSW	2	112908462	missense	probably damaging	1.00
R4917:Ryr3	UTSW	2	112831185	missense	probably damaging	1.00
R4942:Ryr3	UTSW	2	112836257	missense	probably damaging	0.99
R4990:Ryr3	UTSW	2	112635777	missense	probably damaging	1.00
R4990:Ryr3	UTSW	2	112909973	missense	probably damaging	1.00
R5049:Ryr3	UTSW	2	112640171	missense	probably damaging	1.00
R5055:Ryr3	UTSW	2	112831159	missense	probably benign	0.00
R5112:Ryr3	UTSW	2	112902665	missense	probably damaging	1.00
R5160:Ryr3	UTSW	2	112646927	missense	probably damaging	1.00
R5169:Ryr3	UTSW	2	112670660	missense	possibly damaging	0.63
R5176:Ryr3	UTSW	2	112757667	missense	possibly damaging	0.95
R5182:Ryr3	UTSW	2	112755150	missense	probably damaging	1.00
R5206:Ryr3	UTSW	2	112844711	missense	probably damaging	1.00
R5263:Ryr3	UTSW	2	112718002	missense	possibly damaging	0.65
R5272:Ryr3	UTSW	2	112653213	missense	probably damaging	1.00
R5332:Ryr3	UTSW	2	112902693	missense	probably damaging	1.00
R5340:Ryr3	UTSW	2	112834125	missense	probably damaging	0.99
R5359:Ryr3	UTSW	2	112775841	splice site	probably null
R5434:Ryr3	UTSW	2	112794469	missense	probably damaging	1.00
R5454:Ryr3	UTSW	2	112730302	splice site	probably null
R5501:Ryr3	UTSW	2	112662504	missense	possibly damaging	0.80
R5560:Ryr3	UTSW	2	112754877	missense	probably damaging	1.00
R5580:Ryr3	UTSW	2	112841948	missense	probably damaging	1.00
R5621:Ryr3	UTSW	2	112900984	nonsense	probably null
R5731:Ryr3	UTSW	2	112641572	missense	probably damaging	1.00
R5757:Ryr3	UTSW	2	112841975	missense	probably damaging	1.00
R5758:Ryr3	UTSW	2	112841975	missense	probably damaging	1.00
R5768:Ryr3	UTSW	2	112753097	missense	probably benign	0.05
R5783:Ryr3	UTSW	2	112652998	missense	probably benign	0.06
R5799:Ryr3	UTSW	2	112686580	missense	probably damaging	1.00
R5829:Ryr3	UTSW	2	112859731	missense	probably damaging	1.00
R5883:Ryr3	UTSW	2	113030292	intron	probably benign
R5911:Ryr3	UTSW	2	112908487	missense	probably damaging	1.00
R5968:Ryr3	UTSW	2	112647049	missense	probably benign	0.22
R5972:Ryr3	UTSW	2	112834064	missense	probably damaging	0.99
R5978:Ryr3	UTSW	2	112672269	missense	probably benign	0.00
R6084:Ryr3	UTSW	2	112908493	missense	probably damaging	1.00
R6117:Ryr3	UTSW	2	112635396	missense	probably damaging	1.00
R6126:Ryr3	UTSW	2	112757670	missense	probably damaging	1.00
R6128:Ryr3	UTSW	2	112954294	critical splice donor site	probably null
R6157:Ryr3	UTSW	2	112841899	missense	probably damaging	0.98
R6258:Ryr3	UTSW	2	112660104	missense	probably damaging	1.00
R6260:Ryr3	UTSW	2	112660104	missense	probably damaging	1.00
R6373:Ryr3	UTSW	2	112656544	missense	probably damaging	1.00
R6377:Ryr3	UTSW	2	112632185	missense	probably damaging	1.00
R6443:Ryr3	UTSW	2	112675933	missense	possibly damaging	0.88
R6478:Ryr3	UTSW	2	112660068	missense	probably damaging	1.00
R6512:Ryr3	UTSW	2	112867378	missense	possibly damaging	0.83
R6684:Ryr3	UTSW	2	112753088	missense	probably damaging	1.00
R6753:Ryr3	UTSW	2	112652610	missense	probably damaging	0.99
R6812:Ryr3	UTSW	2	112946906	missense	probably damaging	1.00
R6910:Ryr3	UTSW	2	112958175	missense	probably damaging	1.00
R6930:Ryr3	UTSW	2	112860354	missense	probably damaging	1.00
R6946:Ryr3	UTSW	2	112831200	missense	probably damaging	1.00
R6950:Ryr3	UTSW	2	112686825	missense	possibly damaging	0.78
R6973:Ryr3	UTSW	2	112766311	missense	probably damaging	0.99
R6984:Ryr3	UTSW	2	112875091	missense	probably damaging	1.00
R7020:Ryr3	UTSW	2	112753078	missense	probably benign	0.00
R7037:Ryr3	UTSW	2	112949130	nonsense	probably null
R7166:Ryr3	UTSW	2	112875028	missense	probably damaging	1.00
R7172:Ryr3	UTSW	2	112661657	missense	probably damaging	1.00
R7177:Ryr3	UTSW	2	112900843	missense	probably damaging	1.00
R7188:Ryr3	UTSW	2	113028644	missense	probably damaging	1.00
R7202:Ryr3	UTSW	2	112766319	missense	probably damaging	1.00
R7228:Ryr3	UTSW	2	112861852	missense	probably damaging	1.00
R7256:Ryr3	UTSW	2	112672246	nonsense	probably null
R7293:Ryr3	UTSW	2	112902603	missense	probably benign	0.13
R7331:Ryr3	UTSW	2	112763665	missense	possibly damaging	0.80
R7380:Ryr3	UTSW	2	112640157	missense	probably damaging	1.00
R7391:Ryr3	UTSW	2	112780977	critical splice donor site	probably null
R7455:Ryr3	UTSW	2	112728866	missense	probably damaging	0.99
R7466:Ryr3	UTSW	2	112926957	missense	probably benign	0.40
R7481:Ryr3	UTSW	2	112678093	missense	probably benign	0.16
R7481:Ryr3	UTSW	2	112678094	missense	possibly damaging	0.95
R7497:Ryr3	UTSW	2	112730473	missense	probably benign	0.06
R7502:Ryr3	UTSW	2	112712361	missense	probably benign	0.00
R7505:Ryr3	UTSW	2	112712429	missense	probably damaging	0.99
R7581:Ryr3	UTSW	2	112753027	missense	probably damaging	0.99
R7606:Ryr3	UTSW	2	112645245	nonsense	probably null
R7677:Ryr3	UTSW	2	112833900	missense	probably benign
R7703:Ryr3	UTSW	2	112859765	missense	probably damaging	1.00
R7713:Ryr3	UTSW	2	112635346	missense	probably benign	0.12
R7784:Ryr3	UTSW	2	112775695	missense	probably damaging	1.00
R7831:Ryr3	UTSW	2	112926838	missense	possibly damaging	0.92
R7851:Ryr3	UTSW	2	112678517	missense	probably benign	0.05
R7873:Ryr3	UTSW	2	112730428	missense	probably benign	0.28
R7890:Ryr3	UTSW	2	112926912	missense	probably damaging	1.00
R7899:Ryr3	UTSW	2	112646950	missense	possibly damaging	0.86
R7904:Ryr3	UTSW	2	112781024	missense	probably damaging	1.00
R7929:Ryr3	UTSW	2	112834188	missense	probably benign	0.00
R7982:Ryr3	UTSW	2	112669249	small deletion	probably benign
R8018:Ryr3	UTSW	2	112678432	missense	probably damaging	1.00
R8043:Ryr3	UTSW	2	112775664	missense	probably damaging	1.00
R8043:Ryr3	UTSW	2	112875077	missense	probably damaging	1.00
R8095:Ryr3	UTSW	2	112668043	critical splice donor site	probably null
R8097:Ryr3	UTSW	2	112670270	splice site	probably null
R8181:Ryr3	UTSW	2	112778243	missense	probably damaging	0.98
R8276:Ryr3	UTSW	2	112640617	missense	probably damaging	1.00
R8329:Ryr3	UTSW	2	112662510	missense	possibly damaging	0.94
R8345:Ryr3	UTSW	2	112652925	missense	probably benign	0.01
R8361:Ryr3	UTSW	2	112653130	missense	probably damaging	0.98
R8421:Ryr3	UTSW	2	112996584	missense	probably benign	0.00
R8424:Ryr3	UTSW	2	112841894	missense	possibly damaging	0.91
R8471:Ryr3	UTSW	2	112653780	missense	probably damaging	1.00
R8505:Ryr3	UTSW	2	112675870	missense	probably damaging	0.98
R8535:Ryr3	UTSW	2	112949088	critical splice donor site	probably null
R8540:Ryr3	UTSW	2	112800022	missense	probably damaging	1.00
R8722:Ryr3	UTSW	2	112772771	missense	probably benign	0.12
R8818:Ryr3	UTSW	2	112831096	missense	probably damaging	1.00
R8819:Ryr3	UTSW	2	112635792	missense	probably damaging	1.00
R8819:Ryr3	UTSW	2	112859724	missense	probably benign	0.01
R8820:Ryr3	UTSW	2	112635792	missense	probably damaging	1.00
R8820:Ryr3	UTSW	2	112859724	missense	probably benign	0.01
R8852:Ryr3	UTSW	2	112794499	missense	probably damaging	1.00
R8896:Ryr3	UTSW	2	112753050	nonsense	probably null
R8916:Ryr3	UTSW	2	112778290	missense	probably damaging	1.00
R8935:Ryr3	UTSW	2	112678057	missense	probably benign	0.33
R8943:Ryr3	UTSW	2	112635324	missense	probably damaging	1.00
R8963:Ryr3	UTSW	2	112836670	critical splice donor site	probably null
R8974:Ryr3	UTSW	2	112912279	missense	possibly damaging	0.74
R9008:Ryr3	UTSW	2	112635403	missense	probably damaging	0.98
R9040:Ryr3	UTSW	2	112954386	missense	probably damaging	1.00
R9041:Ryr3	UTSW	2	112957201	missense	probably damaging	0.97
R9102:Ryr3	UTSW	2	112678561	splice site	probably benign
R9167:Ryr3	UTSW	2	112834053	missense	probably damaging	1.00
R9180:Ryr3	UTSW	2	112661636	missense	probably damaging	0.99
R9219:Ryr3	UTSW	2	112912239	missense	possibly damaging	0.62
R9258:Ryr3	UTSW	2	112653019	missense	probably damaging	0.99
R9300:Ryr3	UTSW	2	112860350	missense	probably benign
R9320:Ryr3	UTSW	2	112779991	missense	probably damaging	1.00
R9325:Ryr3	UTSW	2	112649295	missense	probably damaging	0.96
R9405:Ryr3	UTSW	2	112834267	missense	probably damaging	1.00
R9414:Ryr3	UTSW	2	112670666	missense	possibly damaging	0.81
R9489:Ryr3	UTSW	2	112661621	missense	probably damaging	1.00
R9522:Ryr3	UTSW	2	112730414	missense	probably benign	0.34
R9526:Ryr3	UTSW	2	112833925	missense	probably benign
R9529:Ryr3	UTSW	2	112635315	missense	possibly damaging	0.70
R9605:Ryr3	UTSW	2	112661621	missense	probably damaging	1.00
R9652:Ryr3	UTSW	2	112804702	missense	possibly damaging	0.66
R9660:Ryr3	UTSW	2	112833729	missense	probably benign
R9670:Ryr3	UTSW	2	112730500	missense	probably benign	0.28
R9673:Ryr3	UTSW	2	112656538	missense	possibly damaging	0.93
R9710:Ryr3	UTSW	2	112803189	missense	probably damaging	0.99
R9741:Ryr3	UTSW	2	112646926	missense	probably benign	0.00
R9772:Ryr3	UTSW	2	112826703	missense	probably damaging	0.96
RF010:Ryr3	UTSW	2	112775670	missense	probably damaging	0.97
RF040:Ryr3	UTSW	2	112910524	critical splice acceptor site	probably benign
RF044:Ryr3	UTSW	2	112910524	critical splice acceptor site	probably benign
X0057:Ryr3	UTSW	2	112640159	missense	probably damaging	1.00
X0064:Ryr3	UTSW	2	112912302	missense	probably benign	0.26
Z1088:Ryr3	UTSW	2	112900916	missense	probably damaging	1.00
Z1176:Ryr3	UTSW	2	112675920	missense	probably benign	0.05
Z1176:Ryr3	UTSW	2	112712374	missense	probably damaging	1.00
Z1176:Ryr3	UTSW	2	112728924	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCATAGTAAAAGCAGAGGCAGACTC -3'
(R):5'- AAGAGTCTGTTGGACCCAGC -3'

Sequencing Primer
(F):5'- GGCAGACTCAAAAGATTTCTCTTCC -3'
(R):5'- GCAGAAAGTGTGCTAAATTACTTCG -3'

Posted On

2021-07-15