Incidental Mutation 'R8859:Ryr3'
ID 675502
Institutional Source Beutler Lab
Gene Symbol Ryr3
Ensembl Gene ENSMUSG00000057378
Gene Name ryanodine receptor 3
Synonyms calcium release channel isoform 3
MMRRC Submission 068739-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.321) question?
Stock # R8859 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 112461700-113047441 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 112483564 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 4091 (V4091A)
Ref Sequence ENSEMBL: ENSMUSP00000089426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080673] [ENSMUST00000091818] [ENSMUST00000134358] [ENSMUST00000208151] [ENSMUST00000208290]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080673
AA Change: V4066A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079503
Gene: ENSMUSG00000057378
AA Change: V4066A

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
MIR 100 155 3.27e-4 SMART
MIR 162 207 7.52e-4 SMART
MIR 215 269 8.06e-4 SMART
MIR 275 368 8.4e-25 SMART
Pfam:RYDR_ITPR 438 642 1.1e-71 PFAM
SPRY 657 795 1.16e-24 SMART
Pfam:RyR 848 942 1.5e-34 PFAM
Pfam:RyR 962 1056 1.2e-32 PFAM
SPRY 1084 1207 7.99e-37 SMART
SPRY 1325 1465 6.25e-30 SMART
low complexity region 1757 1772 N/A INTRINSIC
low complexity region 1773 1788 N/A INTRINSIC
low complexity region 1932 1957 N/A INTRINSIC
Pfam:RYDR_ITPR 2018 2228 1.8e-59 PFAM
Pfam:RyR 2595 2689 1.2e-36 PFAM
Pfam:RyR 2713 2801 2.1e-31 PFAM
low complexity region 2877 2887 N/A INTRINSIC
low complexity region 3169 3184 N/A INTRINSIC
low complexity region 3327 3338 N/A INTRINSIC
PDB:2BCX|B 3462 3491 9e-12 PDB
low complexity region 3532 3540 N/A INTRINSIC
coiled coil region 3585 3614 N/A INTRINSIC
Pfam:RIH_assoc 3715 3848 4.9e-40 PFAM
low complexity region 3855 3875 N/A INTRINSIC
SCOP:d1sra__ 3893 3989 1e-10 SMART
low complexity region 4096 4134 N/A INTRINSIC
transmembrane domain 4178 4200 N/A INTRINSIC
Pfam:RR_TM4-6 4227 4497 4.7e-96 PFAM
Pfam:Ion_trans 4599 4762 2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091818
AA Change: V4091A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000089426
Gene: ENSMUSG00000057378
AA Change: V4091A

DomainStartEndE-ValueType
low complexity region 110 119 N/A INTRINSIC
MIR 120 175 3.27e-4 SMART
MIR 182 227 7.52e-4 SMART
MIR 235 289 8.06e-4 SMART
MIR 295 388 8.4e-25 SMART
Pfam:RYDR_ITPR 460 655 1.2e-64 PFAM
SPRY 677 815 1.16e-24 SMART
Pfam:RyR 869 959 3.3e-38 PFAM
Pfam:RyR 983 1073 2.5e-32 PFAM
SPRY 1104 1227 7.99e-37 SMART
SPRY 1345 1485 6.25e-30 SMART
low complexity region 1777 1792 N/A INTRINSIC
low complexity region 1793 1808 N/A INTRINSIC
low complexity region 1952 1977 N/A INTRINSIC
Pfam:RYDR_ITPR 2040 2248 5.8e-67 PFAM
Pfam:RyR 2616 2706 6.3e-33 PFAM
Pfam:RyR 2734 2818 6.6e-26 PFAM
low complexity region 2897 2907 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
PDB:2BCX|B 3487 3516 1e-11 PDB
low complexity region 3557 3565 N/A INTRINSIC
coiled coil region 3610 3639 N/A INTRINSIC
Pfam:RIH_assoc 3744 3862 3.5e-34 PFAM
low complexity region 3880 3900 N/A INTRINSIC
SCOP:d1sra__ 3918 4014 1e-10 SMART
low complexity region 4121 4159 N/A INTRINSIC
transmembrane domain 4203 4225 N/A INTRINSIC
Pfam:RR_TM4-6 4252 4522 1.1e-98 PFAM
Pfam:Ion_trans 4625 4799 6.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134358
AA Change: V4061A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000208151
AA Change: V4066A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208290
AA Change: V4071A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ryanodine receptor, which functions to release calcium from intracellular storage for use in many cellular processes. For example, the encoded protein is involved in skeletal muscle contraction by releasing calcium from the sarcoplasmic reticulum followed by depolarization of T-tubules. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired muscle contraction at an early age, changes in hippocampal synaptic plasticity, increased locomotor activity with a tendency to circle, and impaired relearning of a spatial task. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(5) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,328,397 (GRCm39) Y3490F Het
Abcc1 T C 16: 14,214,225 (GRCm39) V167A probably benign Het
Abcd2 G A 15: 91,073,149 (GRCm39) R337C probably damaging Het
Adcy1 A G 11: 7,111,877 (GRCm39) D914G probably benign Het
Ahnak G T 19: 8,984,567 (GRCm39) L1950F probably damaging Het
Alox5ap T C 5: 149,201,994 (GRCm39) probably null Het
Ank C T 15: 27,562,834 (GRCm39) H181Y possibly damaging Het
Ankrd44 T A 1: 54,706,680 (GRCm39) D592V possibly damaging Het
Ap4m1 T A 5: 138,174,185 (GRCm39) N185K possibly damaging Het
Arhgef28 T A 13: 98,082,210 (GRCm39) D1199V probably damaging Het
Arnt T C 3: 95,397,691 (GRCm39) probably null Het
Atcay C T 10: 81,060,298 (GRCm39) V13M probably benign Het
B4galt3 T C 1: 171,099,241 (GRCm39) S2P unknown Het
Bicra A T 7: 15,721,737 (GRCm39) S593R possibly damaging Het
Brsk2 A C 7: 141,552,415 (GRCm39) Q633P probably damaging Het
Cacna1c T A 6: 118,653,280 (GRCm39) S909C Het
Ccdc7a G A 8: 129,788,113 (GRCm39) T72M probably benign Het
Ccn1 T C 3: 145,354,380 (GRCm39) D177G probably benign Het
Cct2 A T 10: 116,896,739 (GRCm39) F155I possibly damaging Het
Cdv3 G T 9: 103,233,594 (GRCm39) P194T probably damaging Het
Cenpc1 A T 5: 86,160,153 (GRCm39) V895E probably benign Het
Cep170b T C 12: 112,702,881 (GRCm39) V448A probably benign Het
Chil3 G A 3: 106,071,440 (GRCm39) R75C possibly damaging Het
Cnfn A T 7: 25,067,869 (GRCm39) C24S probably benign Het
Cnga3 A G 1: 37,299,852 (GRCm39) K191E possibly damaging Het
Col12a1 A T 9: 79,587,681 (GRCm39) Y1153* probably null Het
Coq4 C A 2: 29,685,491 (GRCm39) H168Q probably damaging Het
Dennd2b T A 7: 109,123,863 (GRCm39) K1132M probably damaging Het
Dnajc14 G A 10: 128,642,488 (GRCm39) V137I probably benign Het
Efr3a T C 15: 65,726,614 (GRCm39) L569P probably damaging Het
Epb41l3 A T 17: 69,591,575 (GRCm39) E677D probably benign Het
Esp8 G A 17: 40,841,013 (GRCm39) M91I unknown Het
Fubp1 A T 3: 151,937,669 (GRCm39) probably benign Het
Gldc G T 19: 30,116,779 (GRCm39) A391D probably damaging Het
Gm17728 A G 17: 9,641,027 (GRCm39) T46A probably benign Het
Gm5798 A G 14: 41,072,603 (GRCm39) K112E probably damaging Het
Gpnmb A G 6: 49,028,964 (GRCm39) probably benign Het
Grwd1 T C 7: 45,475,298 (GRCm39) T415A probably benign Het
Gsdma3 C G 11: 98,522,086 (GRCm39) A172G possibly damaging Het
Hltf C T 3: 20,119,566 (GRCm39) Q204* probably null Het
Igf1r T G 7: 67,833,211 (GRCm39) V457G possibly damaging Het
Inhbc A T 10: 127,192,984 (GRCm39) M344K probably damaging Het
Jak3 C T 8: 72,131,160 (GRCm39) A60V probably benign Het
Kif13b A G 14: 64,979,882 (GRCm39) T511A probably benign Het
Lama2 T A 10: 27,335,384 (GRCm39) N97I possibly damaging Het
Limd2 T A 11: 106,049,576 (GRCm39) D104V probably damaging Het
Loxl3 T A 6: 83,014,526 (GRCm39) C145S probably damaging Het
Lrrc37 A C 11: 103,506,370 (GRCm39) I1866S unknown Het
Lrrc73 A G 17: 46,565,455 (GRCm39) N62S probably benign Het
Lrrtm4 A G 6: 79,998,870 (GRCm39) D94G probably damaging Het
Lsm3 C A 6: 91,499,252 (GRCm39) F86L probably damaging Het
Map10 T C 8: 126,397,291 (GRCm39) V228A probably benign Het
Mcidas A C 13: 113,130,664 (GRCm39) S54R possibly damaging Het
Me3 T C 7: 89,455,876 (GRCm39) Y243H probably damaging Het
Mgat4b A G 11: 50,121,674 (GRCm39) T89A possibly damaging Het
Mmp16 T A 4: 18,054,355 (GRCm39) probably benign Het
Mtmr9 G A 14: 63,781,226 (GRCm39) probably benign Het
Myo1b G T 1: 51,836,198 (GRCm39) A331E probably damaging Het
Ncoa6 C T 2: 155,248,388 (GRCm39) V1639M possibly damaging Het
Nek9 C T 12: 85,353,120 (GRCm39) G752R probably damaging Het
Nufip2 A G 11: 77,584,069 (GRCm39) Y661C probably benign Het
Or10w1 T A 19: 13,632,246 (GRCm39) V151E probably damaging Het
Or1n2 C T 2: 36,797,516 (GRCm39) A186V possibly damaging Het
Or51t4 A T 7: 102,598,373 (GRCm39) I234F probably damaging Het
Or7g16 T C 9: 18,726,992 (GRCm39) I199M possibly damaging Het
Or8g55 G A 9: 39,784,894 (GRCm39) G108S probably benign Het
Oxct2a A G 4: 123,216,322 (GRCm39) L353S probably benign Het
Parvg A G 15: 84,222,001 (GRCm39) I243V probably benign Het
Pcdhgb7 C A 18: 37,886,349 (GRCm39) N506K possibly damaging Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Pgghg G A 7: 140,525,367 (GRCm39) probably null Het
Phrf1 G T 7: 140,836,516 (GRCm39) G263W unknown Het
Ppfia1 A C 7: 144,032,762 (GRCm39) probably null Het
Prss37 T A 6: 40,491,897 (GRCm39) I228F probably damaging Het
Ptpro A T 6: 137,403,782 (GRCm39) K921* probably null Het
Rictor T G 15: 6,813,067 (GRCm39) L940R probably damaging Het
Rp1 A G 1: 4,420,183 (GRCm39) S310P probably benign Het
Saxo4 T A 19: 10,459,599 (GRCm39) Y36F probably damaging Het
Sirt5 T A 13: 43,524,327 (GRCm39) M33K possibly damaging Het
Slc25a30 T A 14: 76,008,917 (GRCm39) Y90F probably benign Het
Stimate T A 14: 30,588,629 (GRCm39) Y119N probably damaging Het
Stk11 G A 10: 79,964,269 (GRCm39) D388N probably benign Het
Tgm1 C A 14: 55,949,686 (GRCm39) R126L probably benign Het
Tmem129 G T 5: 33,811,837 (GRCm39) T321N probably benign Het
Tnfrsf11a A T 1: 105,772,244 (GRCm39) probably null Het
Tor1aip1 A G 1: 155,907,190 (GRCm39) C195R probably benign Het
Tpr A G 1: 150,284,597 (GRCm39) E428G possibly damaging Het
Trps1 T A 15: 50,685,769 (GRCm39) D802V possibly damaging Het
Usp17lc T A 7: 103,064,316 (GRCm39) S6T probably benign Het
Vangl1 C A 3: 102,065,758 (GRCm39) R459L Het
Vmn1r43 T C 6: 89,846,937 (GRCm39) Y183C probably damaging Het
Vmn2r110 C T 17: 20,794,560 (GRCm39) C703Y probably damaging Het
Vmn2r54 T C 7: 12,363,702 (GRCm39) Q397R possibly damaging Het
Vmn2r88 T C 14: 51,656,263 (GRCm39) V824A probably damaging Het
Vmn2r89 A T 14: 51,693,170 (GRCm39) Y79F probably benign Het
Vnn1 T C 10: 23,780,484 (GRCm39) S491P probably benign Het
Zbbx A G 3: 74,968,741 (GRCm39) F572L unknown Het
Zc3h4 A T 7: 16,168,939 (GRCm39) Q1091L unknown Het
Zfp503 C T 14: 22,037,286 (GRCm39) V106I possibly damaging Het
Zfp874a T C 13: 67,590,647 (GRCm39) T346A probably benign Het
Other mutations in Ryr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Ryr3 APN 2 112,490,494 (GRCm39) missense probably damaging 0.98
IGL00531:Ryr3 APN 2 112,493,357 (GRCm39) splice site probably benign
IGL00785:Ryr3 APN 2 112,666,448 (GRCm39) missense possibly damaging 0.95
IGL00901:Ryr3 APN 2 112,716,934 (GRCm39) missense probably damaging 1.00
IGL00910:Ryr3 APN 2 112,559,279 (GRCm39) splice site probably benign
IGL00970:Ryr3 APN 2 112,595,021 (GRCm39) missense probably damaging 1.00
IGL01083:Ryr3 APN 2 112,582,191 (GRCm39) splice site probably benign
IGL01105:Ryr3 APN 2 112,582,150 (GRCm39) missense probably damaging 1.00
IGL01287:Ryr3 APN 2 112,539,418 (GRCm39) missense probably damaging 1.00
IGL01343:Ryr3 APN 2 112,490,399 (GRCm39) missense probably damaging 1.00
IGL01472:Ryr3 APN 2 112,502,593 (GRCm39) missense probably benign 0.20
IGL01552:Ryr3 APN 2 112,656,228 (GRCm39) missense possibly damaging 0.53
IGL01594:Ryr3 APN 2 112,603,073 (GRCm39) missense probably damaging 1.00
IGL01723:Ryr3 APN 2 112,480,456 (GRCm39) critical splice donor site probably null
IGL01837:Ryr3 APN 2 112,631,665 (GRCm39) missense probably damaging 1.00
IGL01868:Ryr3 APN 2 112,633,503 (GRCm39) splice site probably benign
IGL01907:Ryr3 APN 2 112,699,346 (GRCm39) splice site probably benign
IGL02005:Ryr3 APN 2 112,493,608 (GRCm39) splice site probably benign
IGL02014:Ryr3 APN 2 112,777,260 (GRCm39) missense possibly damaging 0.86
IGL02109:Ryr3 APN 2 112,779,502 (GRCm39) missense probably benign
IGL02178:Ryr3 APN 2 112,656,144 (GRCm39) missense probably benign 0.17
IGL02185:Ryr3 APN 2 112,797,548 (GRCm39) missense probably damaging 0.99
IGL02189:Ryr3 APN 2 112,585,183 (GRCm39) splice site probably benign
IGL02200:Ryr3 APN 2 112,679,855 (GRCm39) missense probably damaging 0.98
IGL02302:Ryr3 APN 2 112,794,701 (GRCm39) missense probably damaging 1.00
IGL02305:Ryr3 APN 2 112,475,622 (GRCm39) missense probably damaging 0.96
IGL02306:Ryr3 APN 2 112,664,459 (GRCm39) missense probably damaging 0.98
IGL02306:Ryr3 APN 2 112,677,744 (GRCm39) critical splice donor site probably null
IGL02340:Ryr3 APN 2 112,777,349 (GRCm39) splice site probably benign
IGL02398:Ryr3 APN 2 112,677,767 (GRCm39) missense probably benign 0.05
IGL02407:Ryr3 APN 2 112,585,303 (GRCm39) missense probably damaging 1.00
IGL02426:Ryr3 APN 2 112,731,250 (GRCm39) missense possibly damaging 0.59
IGL02452:Ryr3 APN 2 112,664,335 (GRCm39) missense probably damaging 1.00
IGL02453:Ryr3 APN 2 112,512,073 (GRCm39) splice site probably benign
IGL02585:Ryr3 APN 2 112,542,648 (GRCm39) missense probably damaging 1.00
IGL02724:Ryr3 APN 2 112,732,921 (GRCm39) critical splice donor site probably null
IGL02817:Ryr3 APN 2 112,674,968 (GRCm39) critical splice donor site probably null
IGL02861:Ryr3 APN 2 112,483,186 (GRCm39) missense possibly damaging 0.89
IGL03038:Ryr3 APN 2 112,498,465 (GRCm39) missense possibly damaging 0.83
IGL03059:Ryr3 APN 2 112,630,392 (GRCm39) missense probably damaging 1.00
IGL03136:Ryr3 APN 2 112,506,319 (GRCm39) splice site probably benign
IGL03137:Ryr3 APN 2 112,740,742 (GRCm39) missense probably benign
IGL03166:Ryr3 APN 2 112,471,457 (GRCm39) nonsense probably null
IGL03177:Ryr3 APN 2 112,859,016 (GRCm39) missense probably benign 0.39
IGL03205:Ryr3 APN 2 112,462,487 (GRCm39) missense probably damaging 1.00
IGL03224:Ryr3 APN 2 112,784,681 (GRCm39) nonsense probably null
IGL03249:Ryr3 APN 2 112,471,001 (GRCm39) missense probably benign 0.32
IGL03370:Ryr3 APN 2 112,586,944 (GRCm39) missense possibly damaging 0.69
intruder UTSW 2 112,502,591 (GRCm39) nonsense probably null
usurper UTSW 2 112,630,367 (GRCm39) missense probably damaging 1.00
ANU74:Ryr3 UTSW 2 112,661,575 (GRCm39) critical splice acceptor site probably null
BB006:Ryr3 UTSW 2 112,664,533 (GRCm39) missense probably benign 0.00
BB016:Ryr3 UTSW 2 112,664,533 (GRCm39) missense probably benign 0.00
F5426:Ryr3 UTSW 2 112,596,683 (GRCm39) splice site probably benign
PIT4494001:Ryr3 UTSW 2 112,672,221 (GRCm39) missense probably damaging 0.99
R0022:Ryr3 UTSW 2 112,471,011 (GRCm39) missense probably damaging 1.00
R0022:Ryr3 UTSW 2 112,471,011 (GRCm39) missense probably damaging 1.00
R0051:Ryr3 UTSW 2 112,699,420 (GRCm39) missense probably damaging 1.00
R0051:Ryr3 UTSW 2 112,699,420 (GRCm39) missense probably damaging 1.00
R0085:Ryr3 UTSW 2 112,690,108 (GRCm39) missense probably damaging 1.00
R0097:Ryr3 UTSW 2 112,630,400 (GRCm39) missense probably damaging 1.00
R0097:Ryr3 UTSW 2 112,630,400 (GRCm39) missense probably damaging 1.00
R0098:Ryr3 UTSW 2 112,731,376 (GRCm39) missense probably damaging 1.00
R0098:Ryr3 UTSW 2 112,731,376 (GRCm39) missense probably damaging 1.00
R0116:Ryr3 UTSW 2 112,633,510 (GRCm39) missense probably damaging 0.99
R0281:Ryr3 UTSW 2 112,517,155 (GRCm39) missense probably damaging 1.00
R0302:Ryr3 UTSW 2 112,477,468 (GRCm39) splice site probably benign
R0306:Ryr3 UTSW 2 112,606,000 (GRCm39) critical splice donor site probably null
R0445:Ryr3 UTSW 2 112,696,399 (GRCm39) missense probably benign 0.16
R0463:Ryr3 UTSW 2 112,492,046 (GRCm39) missense probably damaging 1.00
R0592:Ryr3 UTSW 2 112,508,826 (GRCm39) missense probably damaging 1.00
R0622:Ryr3 UTSW 2 112,492,900 (GRCm39) missense probably damaging 1.00
R0656:Ryr3 UTSW 2 112,478,651 (GRCm39) splice site probably benign
R0735:Ryr3 UTSW 2 112,563,327 (GRCm39) missense probably benign 0.11
R0783:Ryr3 UTSW 2 112,586,672 (GRCm39) splice site probably benign
R0789:Ryr3 UTSW 2 112,611,318 (GRCm39) splice site probably null
R0835:Ryr3 UTSW 2 112,480,483 (GRCm39) missense probably benign 0.16
R0879:Ryr3 UTSW 2 112,860,588 (GRCm39) missense probably benign 0.02
R0924:Ryr3 UTSW 2 112,672,178 (GRCm39) missense probably damaging 1.00
R0930:Ryr3 UTSW 2 112,672,178 (GRCm39) missense probably damaging 1.00
R0931:Ryr3 UTSW 2 112,484,047 (GRCm39) missense probably damaging 1.00
R1037:Ryr3 UTSW 2 112,699,453 (GRCm39) missense probably benign 0.42
R1169:Ryr3 UTSW 2 112,563,359 (GRCm39) missense probably benign 0.01
R1170:Ryr3 UTSW 2 112,777,332 (GRCm39) missense probably damaging 1.00
R1178:Ryr3 UTSW 2 112,794,725 (GRCm39) missense probably benign 0.00
R1187:Ryr3 UTSW 2 112,788,521 (GRCm39) missense probably damaging 1.00
R1289:Ryr3 UTSW 2 112,475,630 (GRCm39) missense probably damaging 1.00
R1337:Ryr3 UTSW 2 112,610,308 (GRCm39) missense possibly damaging 0.46
R1342:Ryr3 UTSW 2 112,581,148 (GRCm39) missense probably damaging 1.00
R1349:Ryr3 UTSW 2 112,664,546 (GRCm39) missense probably damaging 1.00
R1372:Ryr3 UTSW 2 112,664,546 (GRCm39) missense probably damaging 1.00
R1434:Ryr3 UTSW 2 112,475,604 (GRCm39) missense probably damaging 1.00
R1438:Ryr3 UTSW 2 112,588,046 (GRCm39) missense probably benign 0.18
R1467:Ryr3 UTSW 2 112,583,347 (GRCm39) splice site probably benign
R1470:Ryr3 UTSW 2 112,483,352 (GRCm39) missense probably benign
R1470:Ryr3 UTSW 2 112,483,352 (GRCm39) missense probably benign
R1474:Ryr3 UTSW 2 112,740,307 (GRCm39) missense probably damaging 1.00
R1481:Ryr3 UTSW 2 112,466,867 (GRCm39) splice site probably benign
R1513:Ryr3 UTSW 2 112,539,542 (GRCm39) nonsense probably null
R1524:Ryr3 UTSW 2 112,699,427 (GRCm39) missense probably damaging 0.98
R1525:Ryr3 UTSW 2 112,508,435 (GRCm39) missense probably damaging 1.00
R1526:Ryr3 UTSW 2 112,492,002 (GRCm39) missense probably damaging 1.00
R1611:Ryr3 UTSW 2 112,483,850 (GRCm39) missense possibly damaging 0.72
R1640:Ryr3 UTSW 2 112,731,178 (GRCm39) missense probably damaging 1.00
R1662:Ryr3 UTSW 2 112,539,618 (GRCm39) missense probably damaging 0.99
R1764:Ryr3 UTSW 2 112,690,805 (GRCm39) missense probably damaging 1.00
R1769:Ryr3 UTSW 2 112,582,113 (GRCm39) critical splice donor site probably null
R1776:Ryr3 UTSW 2 112,787,598 (GRCm39) missense probably damaging 0.99
R1780:Ryr3 UTSW 2 112,697,637 (GRCm39) missense probably damaging 0.98
R1840:Ryr3 UTSW 2 112,581,165 (GRCm39) missense probably damaging 1.00
R1864:Ryr3 UTSW 2 112,560,673 (GRCm39) missense possibly damaging 0.65
R1872:Ryr3 UTSW 2 112,539,482 (GRCm39) missense possibly damaging 0.94
R1960:Ryr3 UTSW 2 112,624,812 (GRCm39) missense probably damaging 1.00
R1994:Ryr3 UTSW 2 112,484,837 (GRCm39) missense probably null 0.93
R2018:Ryr3 UTSW 2 112,611,410 (GRCm39) missense probably benign 0.24
R2019:Ryr3 UTSW 2 112,611,410 (GRCm39) missense probably benign 0.24
R2029:Ryr3 UTSW 2 112,477,361 (GRCm39) missense possibly damaging 0.82
R2051:Ryr3 UTSW 2 112,586,986 (GRCm39) missense probably damaging 1.00
R2060:Ryr3 UTSW 2 112,784,709 (GRCm39) missense possibly damaging 0.92
R2061:Ryr3 UTSW 2 112,493,349 (GRCm39) missense possibly damaging 0.83
R2067:Ryr3 UTSW 2 112,777,302 (GRCm39) missense probably damaging 1.00
R2106:Ryr3 UTSW 2 112,468,474 (GRCm39) missense probably damaging 1.00
R2129:Ryr3 UTSW 2 112,508,715 (GRCm39) splice site probably benign
R2140:Ryr3 UTSW 2 112,705,493 (GRCm39) missense probably benign 0.01
R2176:Ryr3 UTSW 2 112,496,680 (GRCm39) missense possibly damaging 0.48
R2241:Ryr3 UTSW 2 112,631,737 (GRCm39) missense probably damaging 1.00
R2261:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R2262:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R2276:Ryr3 UTSW 2 112,479,664 (GRCm39) missense possibly damaging 0.79
R2279:Ryr3 UTSW 2 112,479,664 (GRCm39) missense possibly damaging 0.79
R2403:Ryr3 UTSW 2 112,516,973 (GRCm39) missense probably damaging 1.00
R2510:Ryr3 UTSW 2 112,506,249 (GRCm39) missense probably benign 0.18
R2568:Ryr3 UTSW 2 112,506,219 (GRCm39) missense probably damaging 1.00
R3013:Ryr3 UTSW 2 112,470,626 (GRCm39) missense probably damaging 1.00
R3431:Ryr3 UTSW 2 112,486,876 (GRCm39) missense probably damaging 1.00
R3552:Ryr3 UTSW 2 112,582,132 (GRCm39) missense probably damaging 1.00
R3761:Ryr3 UTSW 2 112,585,258 (GRCm39) missense probably benign
R3909:Ryr3 UTSW 2 112,466,953 (GRCm39) missense probably damaging 1.00
R3923:Ryr3 UTSW 2 112,672,218 (GRCm39) missense possibly damaging 0.92
R3924:Ryr3 UTSW 2 112,859,048 (GRCm39) splice site probably benign
R3927:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R3947:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R3949:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R3976:Ryr3 UTSW 2 112,506,182 (GRCm39) missense possibly damaging 0.49
R4004:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R4022:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R4084:Ryr3 UTSW 2 112,731,253 (GRCm39) missense probably damaging 0.99
R4106:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R4108:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R4109:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R4131:Ryr3 UTSW 2 112,757,328 (GRCm39) splice site probably null
R4156:Ryr3 UTSW 2 112,484,020 (GRCm39) missense probably damaging 1.00
R4172:Ryr3 UTSW 2 112,624,815 (GRCm39) missense probably damaging 1.00
R4234:Ryr3 UTSW 2 112,740,752 (GRCm39) missense probably damaging 1.00
R4399:Ryr3 UTSW 2 112,777,189 (GRCm39) missense probably benign 0.01
R4409:Ryr3 UTSW 2 112,560,653 (GRCm39) missense probably damaging 1.00
R4418:Ryr3 UTSW 2 112,661,569 (GRCm39) missense probably damaging 1.00
R4466:Ryr3 UTSW 2 112,483,447 (GRCm39) missense possibly damaging 0.92
R4525:Ryr3 UTSW 2 112,483,966 (GRCm39) missense probably damaging 0.98
R4573:Ryr3 UTSW 2 112,585,519 (GRCm39) splice site probably null
R4589:Ryr3 UTSW 2 112,705,478 (GRCm39) missense probably damaging 1.00
R4653:Ryr3 UTSW 2 112,483,108 (GRCm39) missense probably damaging 1.00
R4664:Ryr3 UTSW 2 112,826,900 (GRCm39) intron probably benign
R4710:Ryr3 UTSW 2 112,596,646 (GRCm39) missense probably damaging 1.00
R4734:Ryr3 UTSW 2 112,740,847 (GRCm39) missense probably damaging 0.99
R4741:Ryr3 UTSW 2 112,633,613 (GRCm39) missense probably damaging 0.99
R4748:Ryr3 UTSW 2 112,794,750 (GRCm39) missense possibly damaging 0.95
R4749:Ryr3 UTSW 2 112,794,750 (GRCm39) missense possibly damaging 0.95
R4754:Ryr3 UTSW 2 112,587,984 (GRCm39) missense possibly damaging 0.94
R4764:Ryr3 UTSW 2 112,563,376 (GRCm39) critical splice acceptor site probably null
R4812:Ryr3 UTSW 2 112,742,581 (GRCm39) missense probably damaging 1.00
R4822:Ryr3 UTSW 2 112,483,090 (GRCm39) missense probably damaging 1.00
R4841:Ryr3 UTSW 2 112,478,718 (GRCm39) missense probably damaging 1.00
R4849:Ryr3 UTSW 2 112,738,807 (GRCm39) missense probably damaging 1.00
R4917:Ryr3 UTSW 2 112,661,530 (GRCm39) missense probably damaging 1.00
R4942:Ryr3 UTSW 2 112,666,602 (GRCm39) missense probably damaging 0.99
R4990:Ryr3 UTSW 2 112,740,318 (GRCm39) missense probably damaging 1.00
R4990:Ryr3 UTSW 2 112,466,122 (GRCm39) missense probably damaging 1.00
R5049:Ryr3 UTSW 2 112,470,516 (GRCm39) missense probably damaging 1.00
R5055:Ryr3 UTSW 2 112,661,504 (GRCm39) missense probably benign 0.00
R5112:Ryr3 UTSW 2 112,733,010 (GRCm39) missense probably damaging 1.00
R5160:Ryr3 UTSW 2 112,477,272 (GRCm39) missense probably damaging 1.00
R5169:Ryr3 UTSW 2 112,501,005 (GRCm39) missense possibly damaging 0.63
R5176:Ryr3 UTSW 2 112,588,012 (GRCm39) missense possibly damaging 0.95
R5182:Ryr3 UTSW 2 112,585,495 (GRCm39) missense probably damaging 1.00
R5206:Ryr3 UTSW 2 112,675,056 (GRCm39) missense probably damaging 1.00
R5263:Ryr3 UTSW 2 112,548,347 (GRCm39) missense possibly damaging 0.65
R5272:Ryr3 UTSW 2 112,483,558 (GRCm39) missense probably damaging 1.00
R5332:Ryr3 UTSW 2 112,733,038 (GRCm39) missense probably damaging 1.00
R5340:Ryr3 UTSW 2 112,664,470 (GRCm39) missense probably damaging 0.99
R5359:Ryr3 UTSW 2 112,606,186 (GRCm39) splice site probably null
R5434:Ryr3 UTSW 2 112,624,814 (GRCm39) missense probably damaging 1.00
R5454:Ryr3 UTSW 2 112,560,647 (GRCm39) splice site probably null
R5501:Ryr3 UTSW 2 112,492,849 (GRCm39) missense possibly damaging 0.80
R5560:Ryr3 UTSW 2 112,585,222 (GRCm39) missense probably damaging 1.00
R5580:Ryr3 UTSW 2 112,672,293 (GRCm39) missense probably damaging 1.00
R5621:Ryr3 UTSW 2 112,731,329 (GRCm39) nonsense probably null
R5731:Ryr3 UTSW 2 112,471,917 (GRCm39) missense probably damaging 1.00
R5757:Ryr3 UTSW 2 112,672,320 (GRCm39) missense probably damaging 1.00
R5758:Ryr3 UTSW 2 112,672,320 (GRCm39) missense probably damaging 1.00
R5768:Ryr3 UTSW 2 112,583,442 (GRCm39) missense probably benign 0.05
R5783:Ryr3 UTSW 2 112,483,343 (GRCm39) missense probably benign 0.06
R5799:Ryr3 UTSW 2 112,516,925 (GRCm39) missense probably damaging 1.00
R5829:Ryr3 UTSW 2 112,690,076 (GRCm39) missense probably damaging 1.00
R5883:Ryr3 UTSW 2 112,860,637 (GRCm39) intron probably benign
R5911:Ryr3 UTSW 2 112,738,832 (GRCm39) missense probably damaging 1.00
R5968:Ryr3 UTSW 2 112,477,394 (GRCm39) missense probably benign 0.22
R5972:Ryr3 UTSW 2 112,664,409 (GRCm39) missense probably damaging 0.99
R5978:Ryr3 UTSW 2 112,502,614 (GRCm39) missense probably benign 0.00
R6084:Ryr3 UTSW 2 112,738,838 (GRCm39) missense probably damaging 1.00
R6117:Ryr3 UTSW 2 112,465,741 (GRCm39) missense probably damaging 1.00
R6126:Ryr3 UTSW 2 112,588,015 (GRCm39) missense probably damaging 1.00
R6128:Ryr3 UTSW 2 112,784,639 (GRCm39) critical splice donor site probably null
R6157:Ryr3 UTSW 2 112,672,244 (GRCm39) missense probably damaging 0.98
R6258:Ryr3 UTSW 2 112,490,449 (GRCm39) missense probably damaging 1.00
R6260:Ryr3 UTSW 2 112,490,449 (GRCm39) missense probably damaging 1.00
R6373:Ryr3 UTSW 2 112,486,889 (GRCm39) missense probably damaging 1.00
R6377:Ryr3 UTSW 2 112,462,530 (GRCm39) missense probably damaging 1.00
R6443:Ryr3 UTSW 2 112,506,278 (GRCm39) missense possibly damaging 0.88
R6478:Ryr3 UTSW 2 112,490,413 (GRCm39) missense probably damaging 1.00
R6512:Ryr3 UTSW 2 112,697,723 (GRCm39) missense possibly damaging 0.83
R6684:Ryr3 UTSW 2 112,583,433 (GRCm39) missense probably damaging 1.00
R6753:Ryr3 UTSW 2 112,482,955 (GRCm39) missense probably damaging 0.99
R6812:Ryr3 UTSW 2 112,777,251 (GRCm39) missense probably damaging 1.00
R6910:Ryr3 UTSW 2 112,788,520 (GRCm39) missense probably damaging 1.00
R6930:Ryr3 UTSW 2 112,690,699 (GRCm39) missense probably damaging 1.00
R6946:Ryr3 UTSW 2 112,661,545 (GRCm39) missense probably damaging 1.00
R6950:Ryr3 UTSW 2 112,517,170 (GRCm39) missense possibly damaging 0.78
R6973:Ryr3 UTSW 2 112,596,656 (GRCm39) missense probably damaging 0.99
R6984:Ryr3 UTSW 2 112,705,436 (GRCm39) missense probably damaging 1.00
R7020:Ryr3 UTSW 2 112,583,423 (GRCm39) missense probably benign 0.00
R7037:Ryr3 UTSW 2 112,779,475 (GRCm39) nonsense probably null
R7166:Ryr3 UTSW 2 112,705,373 (GRCm39) missense probably damaging 1.00
R7172:Ryr3 UTSW 2 112,492,002 (GRCm39) missense probably damaging 1.00
R7177:Ryr3 UTSW 2 112,731,188 (GRCm39) missense probably damaging 1.00
R7188:Ryr3 UTSW 2 112,858,989 (GRCm39) missense probably damaging 1.00
R7202:Ryr3 UTSW 2 112,596,664 (GRCm39) missense probably damaging 1.00
R7228:Ryr3 UTSW 2 112,692,197 (GRCm39) missense probably damaging 1.00
R7256:Ryr3 UTSW 2 112,502,591 (GRCm39) nonsense probably null
R7293:Ryr3 UTSW 2 112,732,948 (GRCm39) missense probably benign 0.13
R7331:Ryr3 UTSW 2 112,594,010 (GRCm39) missense possibly damaging 0.80
R7380:Ryr3 UTSW 2 112,470,502 (GRCm39) missense probably damaging 1.00
R7391:Ryr3 UTSW 2 112,611,322 (GRCm39) critical splice donor site probably null
R7455:Ryr3 UTSW 2 112,559,211 (GRCm39) missense probably damaging 0.99
R7466:Ryr3 UTSW 2 112,757,302 (GRCm39) missense probably benign 0.40
R7481:Ryr3 UTSW 2 112,508,439 (GRCm39) missense possibly damaging 0.95
R7481:Ryr3 UTSW 2 112,508,438 (GRCm39) missense probably benign 0.16
R7497:Ryr3 UTSW 2 112,560,818 (GRCm39) missense probably benign 0.06
R7502:Ryr3 UTSW 2 112,542,706 (GRCm39) missense probably benign 0.00
R7505:Ryr3 UTSW 2 112,542,774 (GRCm39) missense probably damaging 0.99
R7581:Ryr3 UTSW 2 112,583,372 (GRCm39) missense probably damaging 0.99
R7606:Ryr3 UTSW 2 112,475,590 (GRCm39) nonsense probably null
R7677:Ryr3 UTSW 2 112,664,245 (GRCm39) missense probably benign
R7703:Ryr3 UTSW 2 112,690,110 (GRCm39) missense probably damaging 1.00
R7713:Ryr3 UTSW 2 112,465,691 (GRCm39) missense probably benign 0.12
R7784:Ryr3 UTSW 2 112,606,040 (GRCm39) missense probably damaging 1.00
R7831:Ryr3 UTSW 2 112,757,183 (GRCm39) missense possibly damaging 0.92
R7851:Ryr3 UTSW 2 112,508,862 (GRCm39) missense probably benign 0.05
R7873:Ryr3 UTSW 2 112,560,773 (GRCm39) missense probably benign 0.28
R7890:Ryr3 UTSW 2 112,757,257 (GRCm39) missense probably damaging 1.00
R7899:Ryr3 UTSW 2 112,477,295 (GRCm39) missense possibly damaging 0.86
R7904:Ryr3 UTSW 2 112,611,369 (GRCm39) missense probably damaging 1.00
R7929:Ryr3 UTSW 2 112,664,533 (GRCm39) missense probably benign 0.00
R7982:Ryr3 UTSW 2 112,499,594 (GRCm39) small deletion probably benign
R8018:Ryr3 UTSW 2 112,508,777 (GRCm39) missense probably damaging 1.00
R8043:Ryr3 UTSW 2 112,705,422 (GRCm39) missense probably damaging 1.00
R8043:Ryr3 UTSW 2 112,606,009 (GRCm39) missense probably damaging 1.00
R8095:Ryr3 UTSW 2 112,498,388 (GRCm39) critical splice donor site probably null
R8097:Ryr3 UTSW 2 112,500,615 (GRCm39) splice site probably null
R8181:Ryr3 UTSW 2 112,608,588 (GRCm39) missense probably damaging 0.98
R8276:Ryr3 UTSW 2 112,470,962 (GRCm39) missense probably damaging 1.00
R8329:Ryr3 UTSW 2 112,492,855 (GRCm39) missense possibly damaging 0.94
R8345:Ryr3 UTSW 2 112,483,270 (GRCm39) missense probably benign 0.01
R8361:Ryr3 UTSW 2 112,483,475 (GRCm39) missense probably damaging 0.98
R8421:Ryr3 UTSW 2 112,826,929 (GRCm39) missense probably benign 0.00
R8424:Ryr3 UTSW 2 112,672,239 (GRCm39) missense possibly damaging 0.91
R8471:Ryr3 UTSW 2 112,484,125 (GRCm39) missense probably damaging 1.00
R8505:Ryr3 UTSW 2 112,506,215 (GRCm39) missense probably damaging 0.98
R8535:Ryr3 UTSW 2 112,779,433 (GRCm39) critical splice donor site probably null
R8540:Ryr3 UTSW 2 112,630,367 (GRCm39) missense probably damaging 1.00
R8722:Ryr3 UTSW 2 112,603,116 (GRCm39) missense probably benign 0.12
R8818:Ryr3 UTSW 2 112,661,441 (GRCm39) missense probably damaging 1.00
R8819:Ryr3 UTSW 2 112,690,069 (GRCm39) missense probably benign 0.01
R8819:Ryr3 UTSW 2 112,466,137 (GRCm39) missense probably damaging 1.00
R8820:Ryr3 UTSW 2 112,690,069 (GRCm39) missense probably benign 0.01
R8820:Ryr3 UTSW 2 112,466,137 (GRCm39) missense probably damaging 1.00
R8852:Ryr3 UTSW 2 112,624,844 (GRCm39) missense probably damaging 1.00
R8896:Ryr3 UTSW 2 112,583,395 (GRCm39) nonsense probably null
R8916:Ryr3 UTSW 2 112,608,635 (GRCm39) missense probably damaging 1.00
R8935:Ryr3 UTSW 2 112,508,402 (GRCm39) missense probably benign 0.33
R8943:Ryr3 UTSW 2 112,465,669 (GRCm39) missense probably damaging 1.00
R8963:Ryr3 UTSW 2 112,667,015 (GRCm39) critical splice donor site probably null
R8974:Ryr3 UTSW 2 112,742,624 (GRCm39) missense possibly damaging 0.74
R9008:Ryr3 UTSW 2 112,465,748 (GRCm39) missense probably damaging 0.98
R9040:Ryr3 UTSW 2 112,784,731 (GRCm39) missense probably damaging 1.00
R9041:Ryr3 UTSW 2 112,787,546 (GRCm39) missense probably damaging 0.97
R9102:Ryr3 UTSW 2 112,508,906 (GRCm39) splice site probably benign
R9167:Ryr3 UTSW 2 112,664,398 (GRCm39) missense probably damaging 1.00
R9180:Ryr3 UTSW 2 112,491,981 (GRCm39) missense probably damaging 0.99
R9219:Ryr3 UTSW 2 112,742,584 (GRCm39) missense possibly damaging 0.62
R9258:Ryr3 UTSW 2 112,483,364 (GRCm39) missense probably damaging 0.99
R9300:Ryr3 UTSW 2 112,690,695 (GRCm39) missense probably benign
R9320:Ryr3 UTSW 2 112,610,336 (GRCm39) missense probably damaging 1.00
R9325:Ryr3 UTSW 2 112,479,640 (GRCm39) missense probably damaging 0.96
R9405:Ryr3 UTSW 2 112,664,612 (GRCm39) missense probably damaging 1.00
R9414:Ryr3 UTSW 2 112,501,011 (GRCm39) missense possibly damaging 0.81
R9489:Ryr3 UTSW 2 112,491,966 (GRCm39) missense probably damaging 1.00
R9522:Ryr3 UTSW 2 112,560,759 (GRCm39) missense probably benign 0.34
R9526:Ryr3 UTSW 2 112,664,270 (GRCm39) missense probably benign
R9529:Ryr3 UTSW 2 112,465,660 (GRCm39) missense possibly damaging 0.70
R9605:Ryr3 UTSW 2 112,491,966 (GRCm39) missense probably damaging 1.00
R9652:Ryr3 UTSW 2 112,635,047 (GRCm39) missense possibly damaging 0.66
R9660:Ryr3 UTSW 2 112,664,074 (GRCm39) missense probably benign
R9670:Ryr3 UTSW 2 112,560,845 (GRCm39) missense probably benign 0.28
R9673:Ryr3 UTSW 2 112,486,883 (GRCm39) missense possibly damaging 0.93
R9710:Ryr3 UTSW 2 112,633,534 (GRCm39) missense probably damaging 0.99
R9741:Ryr3 UTSW 2 112,477,271 (GRCm39) missense probably benign 0.00
R9772:Ryr3 UTSW 2 112,657,048 (GRCm39) missense probably damaging 0.96
RF010:Ryr3 UTSW 2 112,606,015 (GRCm39) missense probably damaging 0.97
RF040:Ryr3 UTSW 2 112,740,869 (GRCm39) critical splice acceptor site probably benign
RF044:Ryr3 UTSW 2 112,740,869 (GRCm39) critical splice acceptor site probably benign
X0057:Ryr3 UTSW 2 112,470,504 (GRCm39) missense probably damaging 1.00
X0064:Ryr3 UTSW 2 112,742,647 (GRCm39) missense probably benign 0.26
Z1088:Ryr3 UTSW 2 112,731,261 (GRCm39) missense probably damaging 1.00
Z1176:Ryr3 UTSW 2 112,559,269 (GRCm39) missense probably benign 0.01
Z1176:Ryr3 UTSW 2 112,542,719 (GRCm39) missense probably damaging 1.00
Z1176:Ryr3 UTSW 2 112,506,265 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCATAGTAAAAGCAGAGGCAGACTC -3'
(R):5'- AAGAGTCTGTTGGACCCAGC -3'

Sequencing Primer
(F):5'- GGCAGACTCAAAAGATTTCTCTTCC -3'
(R):5'- GCAGAAAGTGTGCTAAATTACTTCG -3'
Posted On 2021-07-15