Mutagenetix > Incidental Mutation

Incidental Mutation 'R8859:Ncoa6'

675503

Institutional Source

Beutler Lab

Gene Symbol

Ncoa6

Ensembl Gene

ENSMUSG00000038369

Gene Name

nuclear receptor coactivator 6

Synonyms

PRIP, ASC-2, NRC, AIB3, RAP250, ASC2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8859 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

155390656-155473894 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 155406468 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1639 (V1639M)

Ref Sequence

ENSEMBL: ENSMUSP00000045386 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043126] [ENSMUST00000109670] [ENSMUST00000123293]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043126
AA Change: V1639M

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000045386
Gene: ENSMUSG00000038369
AA Change: V1639M

Domain	Start	End	E-Value	Type
Pfam:Nucleic_acid_bd	47	190	3.3e-55	PFAM
coiled coil region	256	296	N/A	INTRINSIC
low complexity region	375	383	N/A	INTRINSIC
internal_repeat_1	450	597	3.31e-5	PROSPERO
low complexity region	615	630	N/A	INTRINSIC
internal_repeat_1	636	793	3.31e-5	PROSPERO
low complexity region	844	860	N/A	INTRINSIC
low complexity region	909	931	N/A	INTRINSIC
low complexity region	986	998	N/A	INTRINSIC
low complexity region	1002	1046	N/A	INTRINSIC
low complexity region	1126	1139	N/A	INTRINSIC
low complexity region	1258	1273	N/A	INTRINSIC
low complexity region	1328	1351	N/A	INTRINSIC
low complexity region	1543	1564	N/A	INTRINSIC
low complexity region	1578	1599	N/A	INTRINSIC
low complexity region	1607	1618	N/A	INTRINSIC
low complexity region	1808	1825	N/A	INTRINSIC
low complexity region	1894	1908	N/A	INTRINSIC
low complexity region	2043	2053	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109670
AA Change: V1639M

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105295
Gene: ENSMUSG00000038369
AA Change: V1639M

Domain	Start	End	E-Value	Type
Pfam:Nucleic_acid_bd	45	195	3.6e-60	PFAM
coiled coil region	256	296	N/A	INTRINSIC
low complexity region	375	383	N/A	INTRINSIC
internal_repeat_1	450	597	3.31e-5	PROSPERO
low complexity region	615	630	N/A	INTRINSIC
internal_repeat_1	636	793	3.31e-5	PROSPERO
low complexity region	844	860	N/A	INTRINSIC
low complexity region	909	931	N/A	INTRINSIC
low complexity region	986	998	N/A	INTRINSIC
low complexity region	1002	1046	N/A	INTRINSIC
low complexity region	1126	1139	N/A	INTRINSIC
low complexity region	1258	1273	N/A	INTRINSIC
low complexity region	1328	1351	N/A	INTRINSIC
low complexity region	1543	1564	N/A	INTRINSIC
low complexity region	1578	1599	N/A	INTRINSIC
low complexity region	1607	1618	N/A	INTRINSIC
low complexity region	1808	1825	N/A	INTRINSIC
low complexity region	1894	1908	N/A	INTRINSIC
low complexity region	2043	2053	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123293

SMART Domains

Protein: ENSMUSP00000118113
Gene: ENSMUSG00000038369

Domain	Start	End	E-Value	Type
Pfam:Nucleic_acid_bd	45	195	2.4e-60	PFAM
coiled coil region	256	296	N/A	INTRINSIC
low complexity region	375	383	N/A	INTRINSIC
low complexity region	564	573	N/A	INTRINSIC
low complexity region	615	630	N/A	INTRINSIC
low complexity region	844	860	N/A	INTRINSIC
low complexity region	909	931	N/A	INTRINSIC
low complexity region	986	998	N/A	INTRINSIC
low complexity region	1002	1046	N/A	INTRINSIC
low complexity region	1126	1139	N/A	INTRINSIC
low complexity region	1258	1273	N/A	INTRINSIC
low complexity region	1328	1351	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

99% (95/96)

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit retarded embryonic growth and defects of the placenta, heart, liver, and nervous system. Mutants die around midgestation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,378,397	Y3490F		Het
Abcc1	T	C	16: 14,396,361	V167A	probably benign	Het
Abcd2	G	A	15: 91,188,946	R337C	probably damaging	Het
Adcy1	A	G	11: 7,161,877	D914G	probably benign	Het
Ahnak	G	T	19: 9,007,203	L1950F	probably damaging	Het
Alox5ap	T	C	5: 149,265,184		probably null	Het
Ank	C	T	15: 27,562,748	H181Y	possibly damaging	Het
Ankrd44	T	A	1: 54,667,521	D592V	possibly damaging	Het
Ap4m1	T	A	5: 138,175,923	N185K	possibly damaging	Het
Arhgef28	T	A	13: 97,945,702	D1199V	probably damaging	Het
Arnt	T	C	3: 95,490,380		probably null	Het
Atcay	C	T	10: 81,224,464	V13M	probably benign	Het
B4galt3	T	C	1: 171,271,671	S2P	unknown	Het
Bicra	A	T	7: 15,987,812	S593R	possibly damaging	Het
Brsk2	A	C	7: 141,998,678	Q633P	probably damaging	Het
Cacna1c	T	A	6: 118,676,319	S909C		Het
Ccdc7a	G	A	8: 129,061,632	T72M	probably benign	Het
Cct2	A	T	10: 117,060,834	F155I	possibly damaging	Het
Cdv3	G	T	9: 103,356,395	P194T	probably damaging	Het
Cenpc1	A	T	5: 86,012,294	V895E	probably benign	Het
Cep170b	T	C	12: 112,736,447	V448A	probably benign	Het
Chil3	G	A	3: 106,164,124	R75C	possibly damaging	Het
Cnfn	A	T	7: 25,368,444	C24S	probably benign	Het
Cnga3	A	G	1: 37,260,771	K191E	possibly damaging	Het
Col12a1	A	T	9: 79,680,399	Y1153*	probably null	Het
Coq4	C	A	2: 29,795,479	H168Q	probably damaging	Het
Cyr61	T	C	3: 145,648,625	D177G	probably benign	Het
Dnajc14	G	A	10: 128,806,619	V137I	probably benign	Het
Efr3a	T	C	15: 65,854,765	L569P	probably damaging	Het
Epb41l3	A	T	17: 69,284,580	E677D	probably benign	Het
Esp8	G	A	17: 40,530,122	M91I	unknown	Het
Fubp1	A	T	3: 152,232,032		probably benign	Het
Gldc	G	T	19: 30,139,379	A391D	probably damaging	Het
Gm17728	A	G	17: 9,422,195	T46A	probably benign	Het
Gm5798	A	G	14: 41,350,646	K112E	probably damaging	Het
Gm884	A	C	11: 103,615,544	I1866S	unknown	Het
Gpnmb	A	G	6: 49,052,030		probably benign	Het
Grwd1	T	C	7: 45,825,874	T415A	probably benign	Het
Gsdma3	C	G	11: 98,631,260	A172G	possibly damaging	Het
Hltf	C	T	3: 20,065,402	Q204*	probably null	Het
Igf1r	T	G	7: 68,183,463	V457G	possibly damaging	Het
Inhbc	A	T	10: 127,357,115	M344K	probably damaging	Het
Jak3	C	T	8: 71,678,516	A60V	probably benign	Het
Kif13b	A	G	14: 64,742,433	T511A	probably benign	Het
Lama2	T	A	10: 27,459,388	N97I	possibly damaging	Het
Limd2	T	A	11: 106,158,750	D104V	probably damaging	Het
Loxl3	T	A	6: 83,037,545	C145S	probably damaging	Het
Lrrc73	A	G	17: 46,254,529	N62S	probably benign	Het
Lrrtm4	A	G	6: 80,021,887	D94G	probably damaging	Het
Lsm3	C	A	6: 91,522,270	F86L	probably damaging	Het
Map10	T	C	8: 125,670,552	V228A	probably benign	Het
Mcidas	A	C	13: 112,994,130	S54R	possibly damaging	Het
Me3	T	C	7: 89,806,668	Y243H	probably damaging	Het
Mgat4b	A	G	11: 50,230,847	T89A	possibly damaging	Het
Mmp16	T	A	4: 18,054,355		probably benign	Het
Mtmr9	G	A	14: 63,543,777		probably benign	Het
Myo1b	G	T	1: 51,797,039	A331E	probably damaging	Het
Nek9	C	T	12: 85,306,346	G752R	probably damaging	Het
Nufip2	A	G	11: 77,693,243	Y661C	probably benign	Het
Olfr1490	T	A	19: 13,654,882	V151E	probably damaging	Het
Olfr354	C	T	2: 36,907,504	A186V	possibly damaging	Het
Olfr574	A	T	7: 102,949,166	I234F	probably damaging	Het
Olfr828	T	C	9: 18,815,696	I199M	possibly damaging	Het
Olfr972	G	A	9: 39,873,598	G108S	probably benign	Het
Oxct2a	A	G	4: 123,322,529	L353S	probably benign	Het
Parvg	A	G	15: 84,337,800	I243V	probably benign	Het
Pcdhgb7	C	A	18: 37,753,296	N506K	possibly damaging	Het
Peg10	T	TCCA	6: 4,756,451		probably benign	Het
Pgghg	G	A	7: 140,945,454		probably null	Het
Phrf1	G	T	7: 141,256,603	G263W	unknown	Het
Ppfia1	A	C	7: 144,479,025		probably null	Het
Ppp1r32	T	A	19: 10,482,235	Y36F	probably damaging	Het
Prss37	T	A	6: 40,514,963	I228F	probably damaging	Het
Ptpro	A	T	6: 137,426,784	K921*	probably null	Het
Rictor	T	G	15: 6,783,586	L940R	probably damaging	Het
Rp1	A	G	1: 4,349,960	S310P	probably benign	Het
Ryr3	A	G	2: 112,653,219	V4091A	probably damaging	Het
Sirt5	T	A	13: 43,370,851	M33K	possibly damaging	Het
Slc25a30	T	A	14: 75,771,477	Y90F	probably benign	Het
St5	T	A	7: 109,524,656	K1132M	probably damaging	Het
Stk11	G	A	10: 80,128,435	D388N	probably benign	Het
Tgm1	C	A	14: 55,712,229	R126L	probably benign	Het
Tmem110	T	A	14: 30,866,672	Y119N	probably damaging	Het
Tmem129	G	T	5: 33,654,493	T321N	probably benign	Het
Tnfrsf11a	A	T	1: 105,844,518		probably null	Het
Tor1aip1	A	G	1: 156,031,444	C195R	probably benign	Het
Tpr	A	G	1: 150,408,846	E428G	possibly damaging	Het
Trps1	T	A	15: 50,822,373	D802V	possibly damaging	Het
Usp17lc	T	A	7: 103,415,109	S6T	probably benign	Het
Vangl1	C	A	3: 102,158,442	R459L		Het
Vmn1r43	T	C	6: 89,869,955	Y183C	probably damaging	Het
Vmn2r110	C	T	17: 20,574,298	C703Y	probably damaging	Het
Vmn2r54	T	C	7: 12,629,775	Q397R	possibly damaging	Het
Vmn2r88	T	C	14: 51,418,806	V824A	probably damaging	Het
Vmn2r89	A	T	14: 51,455,713	Y79F	probably benign	Het
Vnn1	T	C	10: 23,904,586	S491P	probably benign	Het
Zbbx	A	G	3: 75,061,434	F572L	unknown	Het
Zc3h4	A	T	7: 16,435,014	Q1091L	unknown	Het
Zfp503	C	T	14: 21,987,218	V106I	possibly damaging	Het
Zfp874a	T	C	13: 67,442,528	T346A	probably benign	Het

Other mutations in Ncoa6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Ncoa6	APN	2	155406208	missense	probably damaging	0.99
IGL00849:Ncoa6	APN	2	155421688	missense	possibly damaging	0.89
IGL00933:Ncoa6	APN	2	155415397	missense	probably damaging	1.00
IGL00981:Ncoa6	APN	2	155406179	missense	probably damaging	0.98
IGL01420:Ncoa6	APN	2	155407587	missense	probably damaging	1.00
IGL02160:Ncoa6	APN	2	155421083	missense	possibly damaging	0.65
IGL03049:Ncoa6	APN	2	155419014	missense	probably damaging	1.00
IGL03194:Ncoa6	APN	2	155415868	missense	possibly damaging	0.94
IGL03269:Ncoa6	APN	2	155406489	missense	probably damaging	0.97
IGL03299:Ncoa6	APN	2	155407287	missense	probably damaging	0.97
IGL03306:Ncoa6	APN	2	155405507	missense	probably benign	0.30
alcoa	UTSW	2	155402664	unclassified	probably benign
Aluminum	UTSW	2	155399693	critical splice acceptor site	probably null
balboa	UTSW	2	155406949	missense	probably benign	0.05
mauna_loa	UTSW	2	155415227	missense	probably damaging	0.99
PIT4466001:Ncoa6	UTSW	2	155405657	missense	probably benign
R0011:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0014:Ncoa6	UTSW	2	155438043	missense	possibly damaging	0.86
R0079:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0080:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0081:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0164:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0166:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0172:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0173:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0245:Ncoa6	UTSW	2	155391211	missense	probably benign	0.00
R0284:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0285:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0285:Ncoa6	UTSW	2	155415701	missense	probably damaging	0.96
R0288:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0539:Ncoa6	UTSW	2	155415697	missense	probably benign	0.08
R0652:Ncoa6	UTSW	2	155391211	missense	probably benign	0.00
R0781:Ncoa6	UTSW	2	155411520	splice site	probably benign
R1053:Ncoa6	UTSW	2	155434040	missense	probably damaging	1.00
R1110:Ncoa6	UTSW	2	155411520	splice site	probably benign
R1420:Ncoa6	UTSW	2	155421153	nonsense	probably null
R1521:Ncoa6	UTSW	2	155415222	missense	possibly damaging	0.78
R1541:Ncoa6	UTSW	2	155415304	missense	probably benign	0.35
R1677:Ncoa6	UTSW	2	155402664	unclassified	probably benign
R1858:Ncoa6	UTSW	2	155421639	missense	probably benign	0.13
R1954:Ncoa6	UTSW	2	155406821	missense	possibly damaging	0.94
R1955:Ncoa6	UTSW	2	155406821	missense	possibly damaging	0.94
R2040:Ncoa6	UTSW	2	155406080	missense	probably damaging	0.98
R2087:Ncoa6	UTSW	2	155406159	nonsense	probably null
R2159:Ncoa6	UTSW	2	155407713	missense	probably damaging	1.00
R2278:Ncoa6	UTSW	2	155407650	missense	possibly damaging	0.94
R2696:Ncoa6	UTSW	2	155438015	missense	probably benign	0.45
R2891:Ncoa6	UTSW	2	155437961	missense	possibly damaging	0.86
R3618:Ncoa6	UTSW	2	155407789	missense	possibly damaging	0.95
R3747:Ncoa6	UTSW	2	155411641	missense	probably benign	0.01
R3778:Ncoa6	UTSW	2	155421195	missense	probably damaging	1.00
R3784:Ncoa6	UTSW	2	155407757	missense	probably damaging	1.00
R3802:Ncoa6	UTSW	2	155405564	missense	probably benign
R3820:Ncoa6	UTSW	2	155406938	missense	probably damaging	1.00
R3821:Ncoa6	UTSW	2	155406938	missense	probably damaging	1.00
R3822:Ncoa6	UTSW	2	155406938	missense	probably damaging	1.00
R3870:Ncoa6	UTSW	2	155415557	splice site	probably null
R4037:Ncoa6	UTSW	2	155407370	missense	probably damaging	0.98
R4488:Ncoa6	UTSW	2	155407476	missense	possibly damaging	0.94
R4719:Ncoa6	UTSW	2	155391161	unclassified	probably benign
R4732:Ncoa6	UTSW	2	155421301	missense	probably damaging	1.00
R4733:Ncoa6	UTSW	2	155421301	missense	probably damaging	1.00
R4829:Ncoa6	UTSW	2	155415227	missense	probably damaging	0.99
R4835:Ncoa6	UTSW	2	155407133	missense	possibly damaging	0.46
R4883:Ncoa6	UTSW	2	155406767	missense	probably benign	0.29
R4967:Ncoa6	UTSW	2	155421332	missense	possibly damaging	0.80
R5021:Ncoa6	UTSW	2	155406949	missense	probably benign	0.05
R5234:Ncoa6	UTSW	2	155438013	missense	probably benign	0.01
R5356:Ncoa6	UTSW	2	155421192	missense	probably damaging	0.99
R5358:Ncoa6	UTSW	2	155406987	missense	probably damaging	0.97
R5375:Ncoa6	UTSW	2	155433995	missense	probably benign	0.16
R5412:Ncoa6	UTSW	2	155407781	missense	possibly damaging	0.95
R5579:Ncoa6	UTSW	2	155406677	missense	probably damaging	1.00
R5618:Ncoa6	UTSW	2	155437897	missense	possibly damaging	0.86
R5641:Ncoa6	UTSW	2	155421836	missense	probably benign	0.22
R5757:Ncoa6	UTSW	2	155411608	missense	probably damaging	1.00
R5761:Ncoa6	UTSW	2	155408141	missense	probably benign	0.11
R5778:Ncoa6	UTSW	2	155406768	missense	probably benign	0.01
R5852:Ncoa6	UTSW	2	155405499	missense	possibly damaging	0.88
R5940:Ncoa6	UTSW	2	155415865	missense	probably damaging	0.98
R6155:Ncoa6	UTSW	2	155407448	missense	probably damaging	1.00
R6374:Ncoa6	UTSW	2	155421156	missense	probably damaging	1.00
R6389:Ncoa6	UTSW	2	155395816	missense	probably damaging	0.98
R6669:Ncoa6	UTSW	2	155399693	critical splice acceptor site	probably null
R7097:Ncoa6	UTSW	2	155438063	missense	probably benign	0.01
R7385:Ncoa6	UTSW	2	155407801	missense	probably damaging	1.00
R7963:Ncoa6	UTSW	2	155405996	missense	probably benign	0.30
R8356:Ncoa6	UTSW	2	155406252	missense	possibly damaging	0.59
R8698:Ncoa6	UTSW	2	155415121	missense	possibly damaging	0.94
R8870:Ncoa6	UTSW	2	155421158	missense	probably damaging	0.99
R9041:Ncoa6	UTSW	2	155415530	missense	possibly damaging	0.89
R9062:Ncoa6	UTSW	2	155421428	missense	probably benign	0.42
R9088:Ncoa6	UTSW	2	155407806	missense	probably damaging	0.98
R9225:Ncoa6	UTSW	2	155407521	missense	possibly damaging	0.95
R9445:Ncoa6	UTSW	2	155408143	missense	probably benign	0.01
R9497:Ncoa6	UTSW	2	155406318	missense	probably damaging	0.97
R9514:Ncoa6	UTSW	2	155406213	missense	probably benign	0.19
R9656:Ncoa6	UTSW	2	155432926	missense	probably damaging	1.00
R9720:Ncoa6	UTSW	2	155408384	missense	probably damaging	0.98
R9732:Ncoa6	UTSW	2	155402716	missense	probably damaging	0.99
RF033:Ncoa6	UTSW	2	155421731	small deletion	probably benign
RF040:Ncoa6	UTSW	2	155421731	small deletion	probably benign
RF048:Ncoa6	UTSW	2	155421712	small deletion	probably benign
X0017:Ncoa6	UTSW	2	155406540	missense	probably benign	0.05
Z1176:Ncoa6	UTSW	2	155421302	missense	probably damaging	0.99
Z1177:Ncoa6	UTSW	2	155406142	missense	possibly damaging	0.67
Z1177:Ncoa6	UTSW	2	155421218	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAACAACTGCGACAGAGG -3'
(R):5'- TGAGGTCAGCTCTAACACTGC -3'

Sequencing Primer
(F):5'- CTGCGACAGAGGGAGGCATC -3'
(R):5'- AAGCATCCCTCCAGTAATGTC -3'

Posted On

2021-07-15