Incidental Mutation 'R8859:Ptpro'
ID675522
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Nameprotein tyrosine phosphatase, receptor type, O
SynonymsPtpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8859 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location137252319-137463233 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 137426784 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 921 (K921*)
Ref Sequence ENSEMBL: ENSMUSP00000076364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167002] [ENSMUST00000167679] [ENSMUST00000203914]
Predicted Effect probably null
Transcript: ENSMUST00000077115
AA Change: K921*
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: K921*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167002
AA Change: K100*
SMART Domains Protein: ENSMUSP00000131764
Gene: ENSMUSG00000030223
AA Change: K100*

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
PTPc 126 386 1.43e-127 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167679
AA Change: K893*
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: K893*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203914
AA Change: K72*
SMART Domains Protein: ENSMUSP00000144870
Gene: ENSMUSG00000030223
AA Change: K72*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
PTPc 98 358 6.1e-130 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,378,397 Y3490F Het
Abcc1 T C 16: 14,396,361 V167A probably benign Het
Abcd2 G A 15: 91,188,946 R337C probably damaging Het
Adcy1 A G 11: 7,161,877 D914G probably benign Het
Ahnak G T 19: 9,007,203 L1950F probably damaging Het
Alox5ap T C 5: 149,265,184 probably null Het
Ank C T 15: 27,562,748 H181Y possibly damaging Het
Ankrd44 T A 1: 54,667,521 D592V possibly damaging Het
Ap4m1 T A 5: 138,175,923 N185K possibly damaging Het
Arhgef28 T A 13: 97,945,702 D1199V probably damaging Het
Arnt T C 3: 95,490,380 probably null Het
Atcay C T 10: 81,224,464 V13M probably benign Het
B4galt3 T C 1: 171,271,671 S2P unknown Het
Bicra A T 7: 15,987,812 S593R possibly damaging Het
Brsk2 A C 7: 141,998,678 Q633P probably damaging Het
Cacna1c T A 6: 118,676,319 S909C Het
Ccdc7a G A 8: 129,061,632 T72M probably benign Het
Cct2 A T 10: 117,060,834 F155I possibly damaging Het
Cdv3 G T 9: 103,356,395 P194T probably damaging Het
Cenpc1 A T 5: 86,012,294 V895E probably benign Het
Cep170b T C 12: 112,736,447 V448A probably benign Het
Chil3 G A 3: 106,164,124 R75C possibly damaging Het
Cnfn A T 7: 25,368,444 C24S probably benign Het
Cnga3 A G 1: 37,260,771 K191E possibly damaging Het
Col12a1 A T 9: 79,680,399 Y1153* probably null Het
Coq4 C A 2: 29,795,479 H168Q probably damaging Het
Cyr61 T C 3: 145,648,625 D177G probably benign Het
Dnajc14 G A 10: 128,806,619 V137I probably benign Het
Efr3a T C 15: 65,854,765 L569P probably damaging Het
Epb41l3 A T 17: 69,284,580 E677D probably benign Het
Esp8 G A 17: 40,530,122 M91I unknown Het
Gldc G T 19: 30,139,379 A391D probably damaging Het
Gm17728 A G 17: 9,422,195 T46A probably benign Het
Gm5798 A G 14: 41,350,646 K112E probably damaging Het
Gm884 A C 11: 103,615,544 I1866S unknown Het
Grwd1 T C 7: 45,825,874 T415A probably benign Het
Gsdma3 C G 11: 98,631,260 A172G possibly damaging Het
Hltf C T 3: 20,065,402 Q204* probably null Het
Igf1r T G 7: 68,183,463 V457G possibly damaging Het
Inhbc A T 10: 127,357,115 M344K probably damaging Het
Jak3 C T 8: 71,678,516 A60V probably benign Het
Kif13b A G 14: 64,742,433 T511A probably benign Het
Lama2 T A 10: 27,459,388 N97I possibly damaging Het
Limd2 T A 11: 106,158,750 D104V probably damaging Het
Loxl3 T A 6: 83,037,545 C145S probably damaging Het
Lrrc73 A G 17: 46,254,529 N62S probably benign Het
Lrrtm4 A G 6: 80,021,887 D94G probably damaging Het
Lsm3 C A 6: 91,522,270 F86L probably damaging Het
Map10 T C 8: 125,670,552 V228A probably benign Het
Mcidas A C 13: 112,994,130 S54R possibly damaging Het
Me3 T C 7: 89,806,668 Y243H probably damaging Het
Mgat4b A G 11: 50,230,847 T89A possibly damaging Het
Mtmr9 G A 14: 63,543,777 probably benign Het
Myo1b G T 1: 51,797,039 A331E probably damaging Het
Ncoa6 C T 2: 155,406,468 V1639M possibly damaging Het
Nek9 C T 12: 85,306,346 G752R probably damaging Het
Nufip2 A G 11: 77,693,243 Y661C probably benign Het
Olfr1490 T A 19: 13,654,882 V151E probably damaging Het
Olfr354 C T 2: 36,907,504 A186V possibly damaging Het
Olfr574 A T 7: 102,949,166 I234F probably damaging Het
Olfr828 T C 9: 18,815,696 I199M possibly damaging Het
Olfr972 G A 9: 39,873,598 G108S probably benign Het
Oxct2a A G 4: 123,322,529 L353S probably benign Het
Parvg A G 15: 84,337,800 I243V probably benign Het
Pcdhgb7 C A 18: 37,753,296 N506K possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pgghg G A 7: 140,945,454 probably null Het
Phrf1 G T 7: 141,256,603 G263W unknown Het
Ppfia1 A C 7: 144,479,025 probably null Het
Ppp1r32 T A 19: 10,482,235 Y36F probably damaging Het
Prss37 T A 6: 40,514,963 I228F probably damaging Het
Rictor T G 15: 6,783,586 L940R probably damaging Het
Rp1 A G 1: 4,349,960 S310P probably benign Het
Ryr3 A G 2: 112,653,219 V4091A probably damaging Het
Sirt5 T A 13: 43,370,851 M33K possibly damaging Het
Slc25a30 T A 14: 75,771,477 Y90F probably benign Het
St5 T A 7: 109,524,656 K1132M probably damaging Het
Stk11 G A 10: 80,128,435 D388N probably benign Het
Tgm1 C A 14: 55,712,229 R126L probably benign Het
Tmem110 T A 14: 30,866,672 Y119N probably damaging Het
Tmem129 G T 5: 33,654,493 T321N probably benign Het
Tnfrsf11a A T 1: 105,844,518 probably null Het
Tor1aip1 A G 1: 156,031,444 C195R probably benign Het
Tpr A G 1: 150,408,846 E428G possibly damaging Het
Trps1 T A 15: 50,822,373 D802V possibly damaging Het
Usp17lc T A 7: 103,415,109 S6T probably benign Het
Vangl1 C A 3: 102,158,442 R459L Het
Vmn1r43 T C 6: 89,869,955 Y183C probably damaging Het
Vmn2r110 C T 17: 20,574,298 C703Y probably damaging Het
Vmn2r54 T C 7: 12,629,775 Q397R possibly damaging Het
Vmn2r88 T C 14: 51,418,806 V824A probably damaging Het
Vnn1 T C 10: 23,904,586 S491P probably benign Het
Zbbx A G 3: 75,061,434 F572L unknown Het
Zc3h4 A T 7: 16,435,014 Q1091L unknown Het
Zfp503 C T 14: 21,987,218 V106I possibly damaging Het
Zfp874a T C 13: 67,442,528 T346A probably benign Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137394909 critical splice donor site probably null
IGL00844:Ptpro APN 6 137414239 missense probably damaging 1.00
IGL00983:Ptpro APN 6 137418248 missense probably benign 0.01
IGL01073:Ptpro APN 6 137377088 missense probably damaging 1.00
IGL01832:Ptpro APN 6 137393668 missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137454700 missense probably benign 0.37
IGL02387:Ptpro APN 6 137410980 missense probably damaging 0.96
IGL02605:Ptpro APN 6 137380318 missense probably benign 0.02
IGL02666:Ptpro APN 6 137378059 missense probably damaging 0.96
IGL03275:Ptpro APN 6 137450006 missense probably damaging 1.00
Brau UTSW 6 137454598 missense probably damaging 1.00
court UTSW 6 137393675 nonsense probably null
Hoff UTSW 6 137443594 missense probably damaging 1.00
Jester UTSW 6 137449917 missense probably damaging 1.00
mann UTSW 6 137411116 splice site probably null
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0020:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0022:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0023:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0024:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0103:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0106:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0316:Ptpro UTSW 6 137376989 missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137368296 missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137414230 missense probably benign 0.04
R0536:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0537:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0552:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0555:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0664:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0708:Ptpro UTSW 6 137386253 missense probably benign 0.26
R0730:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0735:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0738:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0786:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0811:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0812:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0881:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0973:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1259:Ptpro UTSW 6 137392741 missense probably damaging 0.98
R1340:Ptpro UTSW 6 137441081 missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1382:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1385:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1396:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1401:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1416:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1422:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1448:Ptpro UTSW 6 137441116 missense probably damaging 1.00
R1513:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1518:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1526:Ptpro UTSW 6 137461726 missense probably damaging 1.00
R1540:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1571:Ptpro UTSW 6 137378130 missense probably benign
R1573:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1587:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1588:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1649:Ptpro UTSW 6 137444017 nonsense probably null
R1700:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1701:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1745:Ptpro UTSW 6 137400645 missense probably benign 0.03
R1772:Ptpro UTSW 6 137430743 missense probably damaging 1.00
R1911:Ptpro UTSW 6 137400619 splice site probably benign
R1958:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1967:Ptpro UTSW 6 137416865 missense probably benign 0.38
R2025:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2026:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2040:Ptpro UTSW 6 137386164 splice site probably benign
R2115:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2117:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2130:Ptpro UTSW 6 137411116 splice site probably null
R2161:Ptpro UTSW 6 137449887 missense probably benign 0.01
R2431:Ptpro UTSW 6 137443585 nonsense probably null
R2915:Ptpro UTSW 6 137414241 start gained probably benign
R2988:Ptpro UTSW 6 137443599 nonsense probably null
R3772:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3773:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3795:Ptpro UTSW 6 137380309 missense probably benign
R3885:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3886:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3887:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3888:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3893:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4032:Ptpro UTSW 6 137461742 missense probably damaging 1.00
R4133:Ptpro UTSW 6 137420372 missense probably damaging 1.00
R4377:Ptpro UTSW 6 137380266 missense probably benign 0.26
R4455:Ptpro UTSW 6 137393659 missense probably damaging 1.00
R4613:Ptpro UTSW 6 137416836 nonsense probably null
R4827:Ptpro UTSW 6 137442710 missense probably damaging 1.00
R4863:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4870:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R4910:Ptpro UTSW 6 137368338 missense probably damaging 0.99
R4932:Ptpro UTSW 6 137411105 nonsense probably null
R4941:Ptpro UTSW 6 137392765 missense probably damaging 1.00
R4989:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5009:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R5032:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5033:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5162:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5393:Ptpro UTSW 6 137380224 missense probably benign 0.04
R5423:Ptpro UTSW 6 137442707 missense probably damaging 1.00
R5782:Ptpro UTSW 6 137399498 missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137400706 missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137380608 missense probably benign 0.28
R6488:Ptpro UTSW 6 137393675 nonsense probably null
R6494:Ptpro UTSW 6 137382642 missense probably benign 0.20
R6746:Ptpro UTSW 6 137394823 missense probably damaging 1.00
R6763:Ptpro UTSW 6 137418281 splice site probably null
R6888:Ptpro UTSW 6 137380200 missense probably benign 0.30
R6983:Ptpro UTSW 6 137449917 missense probably damaging 1.00
R7019:Ptpro UTSW 6 137380478 missense probably benign
R7218:Ptpro UTSW 6 137454598 missense probably damaging 1.00
R7236:Ptpro UTSW 6 137368337 missense probably damaging 1.00
R7299:Ptpro UTSW 6 137441144 critical splice donor site probably null
R7381:Ptpro UTSW 6 137399561 missense possibly damaging 0.93
R7493:Ptpro UTSW 6 137382649 missense probably benign 0.01
R7733:Ptpro UTSW 6 137414286 nonsense probably null
R7793:Ptpro UTSW 6 137416820 missense probably damaging 0.99
R7804:Ptpro UTSW 6 137399601 splice site probably null
R7833:Ptpro UTSW 6 137416863 nonsense probably null
R7859:Ptpro UTSW 6 137392807 critical splice donor site probably null
R7873:Ptpro UTSW 6 137430739 missense probably benign 0.44
R8042:Ptpro UTSW 6 137416883 missense possibly damaging 0.71
Z1177:Ptpro UTSW 6 137378140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGTCAAAGGTTCTGGTCAT -3'
(R):5'- CCTTTTGACCTGGGTAGCTG -3'

Sequencing Primer
(F):5'- GAAGTTCTACATTTAATCCAGAAG -3'
(R):5'- CTGGACAGGTGATTCCTCATAAGC -3'
Posted On2021-07-15