Incidental Mutation 'R8859:Igf1r'
ID675528
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Nameinsulin-like growth factor I receptor
Synonymsline 186, A330103N21Rik, CD221, hyft, IGF-1R
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8859 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location67952827-68233668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 68183463 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 457 (V457G)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005671
AA Change: V457G

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: V457G

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,378,397 Y3490F Het
Abcc1 T C 16: 14,396,361 V167A probably benign Het
Abcd2 G A 15: 91,188,946 R337C probably damaging Het
Adcy1 A G 11: 7,161,877 D914G probably benign Het
Ahnak G T 19: 9,007,203 L1950F probably damaging Het
Alox5ap T C 5: 149,265,184 probably null Het
Ank C T 15: 27,562,748 H181Y possibly damaging Het
Ankrd44 T A 1: 54,667,521 D592V possibly damaging Het
Ap4m1 T A 5: 138,175,923 N185K possibly damaging Het
Arhgef28 T A 13: 97,945,702 D1199V probably damaging Het
Arnt T C 3: 95,490,380 probably null Het
Atcay C T 10: 81,224,464 V13M probably benign Het
B4galt3 T C 1: 171,271,671 S2P unknown Het
Bicra A T 7: 15,987,812 S593R possibly damaging Het
Brsk2 A C 7: 141,998,678 Q633P probably damaging Het
Cacna1c T A 6: 118,676,319 S909C Het
Ccdc7a G A 8: 129,061,632 T72M probably benign Het
Cct2 A T 10: 117,060,834 F155I possibly damaging Het
Cdv3 G T 9: 103,356,395 P194T probably damaging Het
Cenpc1 A T 5: 86,012,294 V895E probably benign Het
Cep170b T C 12: 112,736,447 V448A probably benign Het
Chil3 G A 3: 106,164,124 R75C possibly damaging Het
Cnfn A T 7: 25,368,444 C24S probably benign Het
Cnga3 A G 1: 37,260,771 K191E possibly damaging Het
Col12a1 A T 9: 79,680,399 Y1153* probably null Het
Coq4 C A 2: 29,795,479 H168Q probably damaging Het
Cyr61 T C 3: 145,648,625 D177G probably benign Het
Dnajc14 G A 10: 128,806,619 V137I probably benign Het
Efr3a T C 15: 65,854,765 L569P probably damaging Het
Epb41l3 A T 17: 69,284,580 E677D probably benign Het
Esp8 G A 17: 40,530,122 M91I unknown Het
Gldc G T 19: 30,139,379 A391D probably damaging Het
Gm17728 A G 17: 9,422,195 T46A probably benign Het
Gm5798 A G 14: 41,350,646 K112E probably damaging Het
Gm884 A C 11: 103,615,544 I1866S unknown Het
Grwd1 T C 7: 45,825,874 T415A probably benign Het
Gsdma3 C G 11: 98,631,260 A172G possibly damaging Het
Hltf C T 3: 20,065,402 Q204* probably null Het
Inhbc A T 10: 127,357,115 M344K probably damaging Het
Jak3 C T 8: 71,678,516 A60V probably benign Het
Kif13b A G 14: 64,742,433 T511A probably benign Het
Lama2 T A 10: 27,459,388 N97I possibly damaging Het
Limd2 T A 11: 106,158,750 D104V probably damaging Het
Loxl3 T A 6: 83,037,545 C145S probably damaging Het
Lrrc73 A G 17: 46,254,529 N62S probably benign Het
Lrrtm4 A G 6: 80,021,887 D94G probably damaging Het
Lsm3 C A 6: 91,522,270 F86L probably damaging Het
Map10 T C 8: 125,670,552 V228A probably benign Het
Mcidas A C 13: 112,994,130 S54R possibly damaging Het
Me3 T C 7: 89,806,668 Y243H probably damaging Het
Mgat4b A G 11: 50,230,847 T89A possibly damaging Het
Mtmr9 G A 14: 63,543,777 probably benign Het
Myo1b G T 1: 51,797,039 A331E probably damaging Het
Ncoa6 C T 2: 155,406,468 V1639M possibly damaging Het
Nek9 C T 12: 85,306,346 G752R probably damaging Het
Nufip2 A G 11: 77,693,243 Y661C probably benign Het
Olfr1490 T A 19: 13,654,882 V151E probably damaging Het
Olfr354 C T 2: 36,907,504 A186V possibly damaging Het
Olfr574 A T 7: 102,949,166 I234F probably damaging Het
Olfr828 T C 9: 18,815,696 I199M possibly damaging Het
Olfr972 G A 9: 39,873,598 G108S probably benign Het
Oxct2a A G 4: 123,322,529 L353S probably benign Het
Parvg A G 15: 84,337,800 I243V probably benign Het
Pcdhgb7 C A 18: 37,753,296 N506K possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pgghg G A 7: 140,945,454 probably null Het
Phrf1 G T 7: 141,256,603 G263W unknown Het
Ppfia1 A C 7: 144,479,025 probably null Het
Ppp1r32 T A 19: 10,482,235 Y36F probably damaging Het
Prss37 T A 6: 40,514,963 I228F probably damaging Het
Ptpro A T 6: 137,426,784 K921* probably null Het
Rictor T G 15: 6,783,586 L940R probably damaging Het
Rp1 A G 1: 4,349,960 S310P probably benign Het
Ryr3 A G 2: 112,653,219 V4091A probably damaging Het
Sirt5 T A 13: 43,370,851 M33K possibly damaging Het
Slc25a30 T A 14: 75,771,477 Y90F probably benign Het
St5 T A 7: 109,524,656 K1132M probably damaging Het
Stk11 G A 10: 80,128,435 D388N probably benign Het
Tgm1 C A 14: 55,712,229 R126L probably benign Het
Tmem110 T A 14: 30,866,672 Y119N probably damaging Het
Tmem129 G T 5: 33,654,493 T321N probably benign Het
Tnfrsf11a A T 1: 105,844,518 probably null Het
Tor1aip1 A G 1: 156,031,444 C195R probably benign Het
Tpr A G 1: 150,408,846 E428G possibly damaging Het
Trps1 T A 15: 50,822,373 D802V possibly damaging Het
Usp17lc T A 7: 103,415,109 S6T probably benign Het
Vangl1 C A 3: 102,158,442 R459L Het
Vmn1r43 T C 6: 89,869,955 Y183C probably damaging Het
Vmn2r110 C T 17: 20,574,298 C703Y probably damaging Het
Vmn2r54 T C 7: 12,629,775 Q397R possibly damaging Het
Vmn2r88 T C 14: 51,418,806 V824A probably damaging Het
Vnn1 T C 10: 23,904,586 S491P probably benign Het
Zbbx A G 3: 75,061,434 F572L unknown Het
Zc3h4 A T 7: 16,435,014 Q1091L unknown Het
Zfp503 C T 14: 21,987,218 V106I possibly damaging Het
Zfp874a T C 13: 67,442,528 T346A probably benign Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 68190023 missense probably benign
IGL00837:Igf1r APN 7 68201352 splice site probably benign
IGL01515:Igf1r APN 7 68207452 missense probably damaging 1.00
IGL01572:Igf1r APN 7 68193441 missense probably benign 0.01
IGL02100:Igf1r APN 7 68189958 missense probably benign 0.05
IGL02506:Igf1r APN 7 68193396 missense probably benign
IGL02672:Igf1r APN 7 68190033 missense probably benign 0.05
IGL02701:Igf1r APN 7 68201249 missense possibly damaging 0.93
IGL02742:Igf1r APN 7 68189991 missense possibly damaging 0.94
IGL03073:Igf1r APN 7 68215043 missense probably damaging 1.00
IGL03257:Igf1r APN 7 68214940 missense probably damaging 1.00
Frufru UTSW 7 68004163 missense probably damaging 1.00
Hungarian UTSW 7 68214997 missense probably damaging 1.00
Mimi UTSW 7 68195026 missense possibly damaging 0.67
Piroshka UTSW 7 68207336 nonsense probably null
Sublime UTSW 7 68004179 missense probably damaging 1.00
Toy UTSW 7 68003972 missense probably damaging 1.00
BB009:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
BB019:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 68226186 small insertion probably benign
FR4737:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226186 small insertion probably benign
PIT4445001:Igf1r UTSW 7 68207463 missense probably damaging 1.00
R0003:Igf1r UTSW 7 68165242 missense probably damaging 1.00
R0184:Igf1r UTSW 7 68226193 missense possibly damaging 0.84
R0538:Igf1r UTSW 7 68207826 missense probably damaging 1.00
R0632:Igf1r UTSW 7 68165155 missense probably damaging 1.00
R0727:Igf1r UTSW 7 68212158 critical splice donor site probably null
R0750:Igf1r UTSW 7 68212091 missense probably damaging 0.99
R1104:Igf1r UTSW 7 68195026 missense possibly damaging 0.67
R1169:Igf1r UTSW 7 68165127 missense probably benign 0.00
R1348:Igf1r UTSW 7 68218468 missense probably damaging 1.00
R1471:Igf1r UTSW 7 68003837 missense probably damaging 0.98
R1580:Igf1r UTSW 7 68207869 missense probably benign
R1745:Igf1r UTSW 7 68169913 missense probably damaging 1.00
R1772:Igf1r UTSW 7 68195074 missense probably benign 0.03
R1789:Igf1r UTSW 7 68214933 nonsense probably null
R1823:Igf1r UTSW 7 68194981 missense possibly damaging 0.77
R1902:Igf1r UTSW 7 68201249 missense possibly damaging 0.93
R1962:Igf1r UTSW 7 68207275 missense probably damaging 0.99
R2179:Igf1r UTSW 7 68003950 missense probably damaging 0.99
R2215:Igf1r UTSW 7 68165234 missense probably benign
R2221:Igf1r UTSW 7 68201962 missense probably damaging 1.00
R2233:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2234:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2235:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R3023:Igf1r UTSW 7 68183399 missense probably benign 0.00
R4044:Igf1r UTSW 7 68190062 missense possibly damaging 0.83
R4226:Igf1r UTSW 7 68195078 nonsense probably null
R4387:Igf1r UTSW 7 68170009 missense probably benign
R4388:Igf1r UTSW 7 68170009 missense probably benign
R4728:Igf1r UTSW 7 68189624 missense probably damaging 1.00
R4781:Igf1r UTSW 7 68165199 missense possibly damaging 0.75
R5254:Igf1r UTSW 7 68207319 missense probably damaging 0.99
R5278:Igf1r UTSW 7 68193418 missense possibly damaging 0.78
R5510:Igf1r UTSW 7 68193359 missense probably benign 0.19
R5522:Igf1r UTSW 7 68183510 missense probably damaging 0.96
R5527:Igf1r UTSW 7 68207821 missense probably damaging 1.00
R5761:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R5849:Igf1r UTSW 7 68190033 missense probably benign
R6189:Igf1r UTSW 7 68207336 nonsense probably null
R6262:Igf1r UTSW 7 68003972 missense probably damaging 1.00
R6285:Igf1r UTSW 7 68004137 missense possibly damaging 0.94
R6318:Igf1r UTSW 7 68165233 missense probably benign 0.02
R6365:Igf1r UTSW 7 68190050 missense probably benign 0.26
R6377:Igf1r UTSW 7 68201250 missense probably benign 0.00
R6831:Igf1r UTSW 7 68207319 missense possibly damaging 0.75
R6848:Igf1r UTSW 7 68004179 missense probably damaging 1.00
R6902:Igf1r UTSW 7 68004163 missense probably damaging 1.00
R7193:Igf1r UTSW 7 68187157 missense probably damaging 1.00
R7373:Igf1r UTSW 7 68195078 nonsense probably null
R7442:Igf1r UTSW 7 68173278 missense probably damaging 1.00
R7903:Igf1r UTSW 7 68184752 missense probably damaging 1.00
R7923:Igf1r UTSW 7 68190101 missense probably damaging 1.00
R7932:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
R8368:Igf1r UTSW 7 68187048 missense probably benign 0.03
R8458:Igf1r UTSW 7 68195629 missense probably benign
R8539:Igf1r UTSW 7 68003848 missense probably benign 0.06
R8704:Igf1r UTSW 7 68170054 splice site probably benign
R8746:Igf1r UTSW 7 68214997 missense probably damaging 1.00
R8829:Igf1r UTSW 7 68226021 missense probably damaging 1.00
R8832:Igf1r UTSW 7 68226021 missense probably damaging 1.00
RF025:Igf1r UTSW 7 68226179 small insertion probably benign
RF032:Igf1r UTSW 7 68226179 small insertion probably benign
RF034:Igf1r UTSW 7 68226176 small insertion probably benign
RF037:Igf1r UTSW 7 68226176 small insertion probably benign
RF039:Igf1r UTSW 7 68226176 small insertion probably benign
RF044:Igf1r UTSW 7 68226179 small insertion probably benign
Z1186:Igf1r UTSW 7 68226168 small insertion probably benign
Z1186:Igf1r UTSW 7 68226169 small insertion probably benign
Z1186:Igf1r UTSW 7 68226174 small insertion probably benign
Z1186:Igf1r UTSW 7 68226180 small insertion probably benign
Z1186:Igf1r UTSW 7 68226182 small insertion probably benign
Z1191:Igf1r UTSW 7 68226169 small insertion probably benign
Z1191:Igf1r UTSW 7 68226170 small insertion probably benign
Z1191:Igf1r UTSW 7 68226173 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TATGGAACTACACTGGCCGC -3'
(R):5'- GCAGTGGTTTGACAGTCCATGG -3'

Sequencing Primer
(F):5'- ACTACACTGGCCGCAGAGAG -3'
(R):5'- GTTTGACAGTCCATGGTGAAAC -3'
Posted On2021-07-15