Incidental Mutation 'R8859:Ppfia1'
ID 675536
Institutional Source Beutler Lab
Gene Symbol Ppfia1
Ensembl Gene ENSMUSG00000037519
Gene Name protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Synonyms Liprin-alpha1, liprin, C030014K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.895) question?
Stock # R8859 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 144476758-144553729 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 144479025 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168134] [ENSMUST00000182226]
AlphaFold B2RXQ2
Predicted Effect probably benign
Transcript: ENSMUST00000168134
SMART Domains Protein: ENSMUSP00000126233
Gene: ENSMUSG00000037519

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
coiled coil region 36 137 N/A INTRINSIC
coiled coil region 250 517 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
coiled coil region 621 667 N/A INTRINSIC
low complexity region 681 703 N/A INTRINSIC
low complexity region 750 760 N/A INTRINSIC
low complexity region 791 799 N/A INTRINSIC
SAM 884 953 5.22e-7 SMART
low complexity region 954 966 N/A INTRINSIC
SAM 999 1066 3.89e-6 SMART
SAM 1087 1159 1.14e-7 SMART
low complexity region 1207 1218 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182226
SMART Domains Protein: ENSMUSP00000138312
Gene: ENSMUSG00000037519

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
coiled coil region 36 137 N/A INTRINSIC
coiled coil region 250 389 N/A INTRINSIC
coiled coil region 411 542 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
coiled coil region 646 692 N/A INTRINSIC
low complexity region 706 728 N/A INTRINSIC
low complexity region 775 785 N/A INTRINSIC
low complexity region 816 824 N/A INTRINSIC
SAM 909 978 5.22e-7 SMART
low complexity region 979 991 N/A INTRINSIC
SAM 1024 1091 3.89e-6 SMART
SAM 1112 1184 1.14e-7 SMART
low complexity region 1232 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182958
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. This protein binds to the intracellular membrane-distal phosphatase domain of tyrosine phosphatase LAR, and appears to localize LAR to cell focal adhesions. This interaction may regulate the disassembly of focal adhesion and thus help orchestrate cell-matrix interactions. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,378,397 Y3490F Het
Abcc1 T C 16: 14,396,361 V167A probably benign Het
Abcd2 G A 15: 91,188,946 R337C probably damaging Het
Adcy1 A G 11: 7,161,877 D914G probably benign Het
Ahnak G T 19: 9,007,203 L1950F probably damaging Het
Alox5ap T C 5: 149,265,184 probably null Het
Ank C T 15: 27,562,748 H181Y possibly damaging Het
Ankrd44 T A 1: 54,667,521 D592V possibly damaging Het
Ap4m1 T A 5: 138,175,923 N185K possibly damaging Het
Arhgef28 T A 13: 97,945,702 D1199V probably damaging Het
Arnt T C 3: 95,490,380 probably null Het
Atcay C T 10: 81,224,464 V13M probably benign Het
B4galt3 T C 1: 171,271,671 S2P unknown Het
Bicra A T 7: 15,987,812 S593R possibly damaging Het
Brsk2 A C 7: 141,998,678 Q633P probably damaging Het
Cacna1c T A 6: 118,676,319 S909C Het
Ccdc7a G A 8: 129,061,632 T72M probably benign Het
Cct2 A T 10: 117,060,834 F155I possibly damaging Het
Cdv3 G T 9: 103,356,395 P194T probably damaging Het
Cenpc1 A T 5: 86,012,294 V895E probably benign Het
Cep170b T C 12: 112,736,447 V448A probably benign Het
Chil3 G A 3: 106,164,124 R75C possibly damaging Het
Cnfn A T 7: 25,368,444 C24S probably benign Het
Cnga3 A G 1: 37,260,771 K191E possibly damaging Het
Col12a1 A T 9: 79,680,399 Y1153* probably null Het
Coq4 C A 2: 29,795,479 H168Q probably damaging Het
Cyr61 T C 3: 145,648,625 D177G probably benign Het
Dnajc14 G A 10: 128,806,619 V137I probably benign Het
Efr3a T C 15: 65,854,765 L569P probably damaging Het
Epb41l3 A T 17: 69,284,580 E677D probably benign Het
Esp8 G A 17: 40,530,122 M91I unknown Het
Fubp1 A T 3: 152,232,032 probably benign Het
Gldc G T 19: 30,139,379 A391D probably damaging Het
Gm17728 A G 17: 9,422,195 T46A probably benign Het
Gm5798 A G 14: 41,350,646 K112E probably damaging Het
Gm884 A C 11: 103,615,544 I1866S unknown Het
Gpnmb A G 6: 49,052,030 probably benign Het
Grwd1 T C 7: 45,825,874 T415A probably benign Het
Gsdma3 C G 11: 98,631,260 A172G possibly damaging Het
Hltf C T 3: 20,065,402 Q204* probably null Het
Igf1r T G 7: 68,183,463 V457G possibly damaging Het
Inhbc A T 10: 127,357,115 M344K probably damaging Het
Jak3 C T 8: 71,678,516 A60V probably benign Het
Kif13b A G 14: 64,742,433 T511A probably benign Het
Lama2 T A 10: 27,459,388 N97I possibly damaging Het
Limd2 T A 11: 106,158,750 D104V probably damaging Het
Loxl3 T A 6: 83,037,545 C145S probably damaging Het
Lrrc73 A G 17: 46,254,529 N62S probably benign Het
Lrrtm4 A G 6: 80,021,887 D94G probably damaging Het
Lsm3 C A 6: 91,522,270 F86L probably damaging Het
Map10 T C 8: 125,670,552 V228A probably benign Het
Mcidas A C 13: 112,994,130 S54R possibly damaging Het
Me3 T C 7: 89,806,668 Y243H probably damaging Het
Mgat4b A G 11: 50,230,847 T89A possibly damaging Het
Mmp16 T A 4: 18,054,355 probably benign Het
Mtmr9 G A 14: 63,543,777 probably benign Het
Myo1b G T 1: 51,797,039 A331E probably damaging Het
Ncoa6 C T 2: 155,406,468 V1639M possibly damaging Het
Nek9 C T 12: 85,306,346 G752R probably damaging Het
Nufip2 A G 11: 77,693,243 Y661C probably benign Het
Olfr1490 T A 19: 13,654,882 V151E probably damaging Het
Olfr354 C T 2: 36,907,504 A186V possibly damaging Het
Olfr574 A T 7: 102,949,166 I234F probably damaging Het
Olfr828 T C 9: 18,815,696 I199M possibly damaging Het
Olfr972 G A 9: 39,873,598 G108S probably benign Het
Oxct2a A G 4: 123,322,529 L353S probably benign Het
Parvg A G 15: 84,337,800 I243V probably benign Het
Pcdhgb7 C A 18: 37,753,296 N506K possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pgghg G A 7: 140,945,454 probably null Het
Phrf1 G T 7: 141,256,603 G263W unknown Het
Ppp1r32 T A 19: 10,482,235 Y36F probably damaging Het
Prss37 T A 6: 40,514,963 I228F probably damaging Het
Ptpro A T 6: 137,426,784 K921* probably null Het
Rictor T G 15: 6,783,586 L940R probably damaging Het
Rp1 A G 1: 4,349,960 S310P probably benign Het
Ryr3 A G 2: 112,653,219 V4091A probably damaging Het
Sirt5 T A 13: 43,370,851 M33K possibly damaging Het
Slc25a30 T A 14: 75,771,477 Y90F probably benign Het
St5 T A 7: 109,524,656 K1132M probably damaging Het
Stk11 G A 10: 80,128,435 D388N probably benign Het
Tgm1 C A 14: 55,712,229 R126L probably benign Het
Tmem110 T A 14: 30,866,672 Y119N probably damaging Het
Tmem129 G T 5: 33,654,493 T321N probably benign Het
Tnfrsf11a A T 1: 105,844,518 probably null Het
Tor1aip1 A G 1: 156,031,444 C195R probably benign Het
Tpr A G 1: 150,408,846 E428G possibly damaging Het
Trps1 T A 15: 50,822,373 D802V possibly damaging Het
Usp17lc T A 7: 103,415,109 S6T probably benign Het
Vangl1 C A 3: 102,158,442 R459L Het
Vmn1r43 T C 6: 89,869,955 Y183C probably damaging Het
Vmn2r110 C T 17: 20,574,298 C703Y probably damaging Het
Vmn2r54 T C 7: 12,629,775 Q397R possibly damaging Het
Vmn2r88 T C 14: 51,418,806 V824A probably damaging Het
Vmn2r89 A T 14: 51,455,713 Y79F probably benign Het
Vnn1 T C 10: 23,904,586 S491P probably benign Het
Zbbx A G 3: 75,061,434 F572L unknown Het
Zc3h4 A T 7: 16,435,014 Q1091L unknown Het
Zfp503 C T 14: 21,987,218 V106I possibly damaging Het
Zfp874a T C 13: 67,442,528 T346A probably benign Het
Other mutations in Ppfia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Ppfia1 APN 7 144481719 missense probably benign 0.00
IGL01771:Ppfia1 APN 7 144482357 missense probably benign 0.36
IGL02220:Ppfia1 APN 7 144481775 missense probably damaging 1.00
IGL02683:Ppfia1 APN 7 144513358 missense probably damaging 0.99
IGL02752:Ppfia1 APN 7 144519604 missense probably benign
PIT1430001:Ppfia1 UTSW 7 144498336 missense probably damaging 1.00
R0081:Ppfia1 UTSW 7 144504974 missense probably damaging 1.00
R0304:Ppfia1 UTSW 7 144482345 missense probably damaging 1.00
R0359:Ppfia1 UTSW 7 144485192 missense probably damaging 0.97
R1836:Ppfia1 UTSW 7 144519631 missense probably benign 0.19
R1934:Ppfia1 UTSW 7 144505110 missense probably benign 0.12
R2195:Ppfia1 UTSW 7 144516107 missense probably damaging 1.00
R3759:Ppfia1 UTSW 7 144516002 missense probably benign 0.34
R3843:Ppfia1 UTSW 7 144504970 missense probably benign 0.31
R4606:Ppfia1 UTSW 7 144485192 missense probably damaging 0.97
R4820:Ppfia1 UTSW 7 144498369 missense probably benign 0.33
R4898:Ppfia1 UTSW 7 144491576 missense probably damaging 1.00
R5069:Ppfia1 UTSW 7 144514473 nonsense probably null
R5070:Ppfia1 UTSW 7 144514473 nonsense probably null
R5076:Ppfia1 UTSW 7 144506264 missense probably damaging 1.00
R5280:Ppfia1 UTSW 7 144485095 missense possibly damaging 0.84
R5473:Ppfia1 UTSW 7 144491492 missense probably benign 0.17
R5656:Ppfia1 UTSW 7 144519974 critical splice donor site probably null
R5818:Ppfia1 UTSW 7 144520568 intron probably benign
R6104:Ppfia1 UTSW 7 144491574 missense possibly damaging 0.95
R6299:Ppfia1 UTSW 7 144510312 missense probably benign 0.11
R6474:Ppfia1 UTSW 7 144506205 missense possibly damaging 0.89
R6705:Ppfia1 UTSW 7 144519174 missense possibly damaging 0.93
R6734:Ppfia1 UTSW 7 144479053 missense probably damaging 1.00
R7062:Ppfia1 UTSW 7 144552473 missense probably benign
R7451:Ppfia1 UTSW 7 144508210 missense probably benign
R7514:Ppfia1 UTSW 7 144517713 missense probably benign 0.01
R7552:Ppfia1 UTSW 7 144506245 missense probably damaging 1.00
R7633:Ppfia1 UTSW 7 144552436 missense possibly damaging 0.89
R7886:Ppfia1 UTSW 7 144519283 missense probably benign
R8038:Ppfia1 UTSW 7 144514916 missense possibly damaging 0.67
R8139:Ppfia1 UTSW 7 144520693 missense probably damaging 1.00
R8266:Ppfia1 UTSW 7 144514494 missense possibly damaging 0.72
R9621:Ppfia1 UTSW 7 144498779 missense probably damaging 1.00
R9722:Ppfia1 UTSW 7 144517665 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TGTGGCCACTGTCCACCA -3'
(R):5'- TGGGCCACCATGGTGTTCT -3'

Sequencing Primer
(F):5'- ACCTGTTGCACCAAGTGTCAG -3'
(R):5'- ATCACTCCGGAAGTCCTGTTAGTG -3'
Posted On 2021-07-15