Incidental Mutation 'R0731:Olfr484'
ID67554
Institutional Source Beutler Lab
Gene Symbol Olfr484
Ensembl Gene ENSMUSG00000110171
Gene Nameolfactory receptor 484
SynonymsMOR204-16, GA_x6K02T2PBJ9-10454128-10453163
MMRRC Submission 038912-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R0731 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108120691-108127449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108124734 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 176 (I176M)
Ref Sequence ENSEMBL: ENSMUSP00000150774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000210881] [ENSMUST00000214722]
Predicted Effect probably benign
Transcript: ENSMUST00000073580
AA Change: I176M

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073267
Gene: ENSMUSG00000059996
AA Change: I176M

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.5e-53 PFAM
Pfam:7tm_1 44 293 4.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157612
Predicted Effect probably benign
Transcript: ENSMUST00000210881
AA Change: I176M

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000214722
AA Change: I176M

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,586,203 T66A probably damaging Het
4933406M09Rik A C 1: 134,389,975 M162L probably benign Het
Acsm3 A T 7: 119,768,024 R27* probably null Het
Actg1 A G 11: 120,346,949 F255S probably damaging Het
Ahdc1 T A 4: 133,062,951 V501E possibly damaging Het
Alpk2 A T 18: 65,305,390 D1444E probably damaging Het
Btaf1 T G 19: 36,997,495 probably null Het
Cacnb2 A G 2: 14,985,706 H489R possibly damaging Het
Ccdc162 C A 10: 41,579,143 K398N probably damaging Het
Cd79b G T 11: 106,312,433 S145R probably damaging Het
Cdh11 T A 8: 102,668,019 N264Y probably damaging Het
Celsr1 T C 15: 85,901,597 D2892G probably benign Het
Chuk A G 19: 44,103,766 probably benign Het
Clk3 T C 9: 57,751,126 probably benign Het
Dcaf8 A T 1: 172,172,509 D78V possibly damaging Het
Dctn1 A G 6: 83,183,089 T87A probably damaging Het
Ddx50 T C 10: 62,616,249 N732D unknown Het
Dnah5 A T 15: 28,311,143 Y1756F possibly damaging Het
Dock3 A T 9: 106,969,856 V858E probably damaging Het
Fer1l4 A G 2: 156,024,070 F1566S probably benign Het
Fpr-rs7 T C 17: 20,113,854 I125V probably benign Het
Fuca2 C T 10: 13,506,027 P228L probably benign Het
Galntl6 A G 8: 58,535,984 F57L probably benign Het
Gigyf2 T A 1: 87,407,727 probably benign Het
Gm16505 A T 13: 3,361,329 noncoding transcript Het
Gm4781 T C 10: 100,396,777 noncoding transcript Het
Gm9956 T A 10: 56,745,543 Y100* probably null Het
Gpr137c T A 14: 45,246,349 C178S probably damaging Het
Gpr83 A G 9: 14,868,644 R331G probably benign Het
Hlcs T A 16: 94,131,852 H851L probably damaging Het
Kbtbd6 C A 14: 79,451,884 Y6* probably null Het
Kif23 T C 9: 61,925,032 R610G possibly damaging Het
Kifc3 G A 8: 95,105,733 T487I probably damaging Het
Klra5 A C 6: 129,908,796 D133E possibly damaging Het
Klra6 T C 6: 130,022,705 E100G probably damaging Het
Klre1 T A 6: 129,585,568 probably benign Het
Lancl1 C T 1: 67,009,910 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Man1b1 A G 2: 25,338,155 I146V possibly damaging Het
Map4k5 T A 12: 69,874,264 probably benign Het
Mast3 A G 8: 70,781,321 S178P probably damaging Het
Mau2 A G 8: 70,023,612 probably null Het
Mkrn2 A T 6: 115,614,651 N312Y probably damaging Het
Mrvi1 T C 7: 110,876,900 S615G probably benign Het
Myh1 A G 11: 67,202,533 E150G probably damaging Het
Myo7b T A 18: 31,961,825 probably null Het
Nyap1 A G 5: 137,735,298 V491A probably damaging Het
Olfr1284 A G 2: 111,379,293 M98V probably damaging Het
Olfr518 A T 7: 108,881,533 N24K probably damaging Het
Olfr954 T C 9: 39,461,532 F34L probably damaging Het
Oxsm A T 14: 16,240,893 H385Q probably damaging Het
Pbld2 T C 10: 63,056,811 S242P probably damaging Het
Pdzd7 T C 19: 45,029,305 Y675C probably damaging Het
Pnkd T A 1: 74,351,541 H266Q probably damaging Het
Rbfox2 A G 15: 77,099,279 S141P probably benign Het
Rdx A G 9: 52,068,218 T214A probably benign Het
Ripor2 A T 13: 24,680,644 E219V probably damaging Het
Rufy2 G A 10: 63,011,844 probably benign Het
Slf2 T A 19: 44,975,726 probably benign Het
Snrnp200 G T 2: 127,226,145 probably benign Het
Snx7 T A 3: 117,829,671 probably benign Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Tacr3 G A 3: 134,855,000 probably null Het
Tcerg1 C T 18: 42,571,840 T978M probably damaging Het
Tcf7l1 G T 6: 72,788,269 P126Q possibly damaging Het
Trank1 A G 9: 111,365,488 D860G probably damaging Het
Try4 T C 6: 41,304,367 L81P probably benign Het
Ucp1 T C 8: 83,297,847 probably benign Het
Ugt2b38 G A 5: 87,420,452 A328V probably damaging Het
Wfikkn1 T A 17: 25,878,017 R444S probably damaging Het
Zfc3h1 A G 10: 115,410,632 T875A probably benign Het
Zfp11 A G 5: 129,657,264 S378P probably damaging Het
Zfp984 T A 4: 147,756,232 N54I probably damaging Het
Other mutations in Olfr484
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Olfr484 APN 7 108125164 missense possibly damaging 0.88
IGL01899:Olfr484 APN 7 108124841 missense probably benign 0.01
IGL02124:Olfr484 APN 7 108125042 missense probably benign 0.01
IGL02622:Olfr484 APN 7 108124388 missense probably damaging 1.00
IGL03188:Olfr484 APN 7 108124634 missense probably benign 0.00
R0389:Olfr484 UTSW 7 108124816 missense probably benign 0.00
R0443:Olfr484 UTSW 7 108124816 missense probably benign 0.00
R1061:Olfr484 UTSW 7 108124456 missense probably damaging 1.00
R1505:Olfr484 UTSW 7 108124993 missense probably benign 0.00
R1591:Olfr484 UTSW 7 108124364 missense possibly damaging 0.56
R1789:Olfr484 UTSW 7 108124915 missense probably benign 0.44
R2988:Olfr484 UTSW 7 108124838 nonsense probably null
R4778:Olfr484 UTSW 7 108124480 missense possibly damaging 0.95
R5288:Olfr484 UTSW 7 108125168 missense probably benign 0.00
R5644:Olfr484 UTSW 7 108124651 missense probably benign 0.04
R6112:Olfr484 UTSW 7 108125162 missense probably benign 0.01
R6351:Olfr484 UTSW 7 108124430 missense probably damaging 1.00
R6934:Olfr484 UTSW 7 108124819 missense probably benign 0.14
R7094:Olfr484 UTSW 7 108124633 missense probably benign 0.35
R7135:Olfr484 UTSW 7 108124574 missense probably damaging 0.99
R7422:Olfr484 UTSW 7 108124861 missense probably damaging 1.00
R7660:Olfr484 UTSW 7 108124834 missense probably benign 0.04
R7916:Olfr484 UTSW 7 108125122 missense possibly damaging 0.59
X0021:Olfr484 UTSW 7 108125107 missense probably damaging 1.00
X0025:Olfr484 UTSW 7 108124399 nonsense probably null
Z1176:Olfr484 UTSW 7 108124879 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTATCTTGACTTGGGCATCACG -3'
(R):5'- TCGCTTTGTAGCGATCTGCAACC -3'

Sequencing Primer
(F):5'- CTTGACTTGGGCATCACGTAAATG -3'
(R):5'- TAGCGATCTGCAACCCACTG -3'
Posted On2013-09-03