Incidental Mutation 'R8859:Cep170b'
ID 675559
Institutional Source Beutler Lab
Gene Symbol Cep170b
Ensembl Gene ENSMUSG00000072825
Gene Name centrosomal protein 170B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock # R8859 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 112720455-112746592 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 112736447 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 448 (V448A)
Ref Sequence ENSEMBL: ENSMUSP00000098580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092279] [ENSMUST00000101018] [ENSMUST00000179041] [ENSMUST00000220627] [ENSMUST00000222711]
AlphaFold Q80U49
Predicted Effect probably benign
Transcript: ENSMUST00000092279
SMART Domains Protein: ENSMUSP00000089930
Gene: ENSMUSG00000072825

DomainStartEndE-ValueType
FHA 22 73 4.65e-10 SMART
Pfam:CEP170_C 204 598 8.9e-174 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101018
AA Change: V448A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098580
Gene: ENSMUSG00000072825
AA Change: V448A

DomainStartEndE-ValueType
FHA 22 73 4.65e-10 SMART
low complexity region 370 382 N/A INTRINSIC
low complexity region 535 548 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
Pfam:CEP170_C 831 1514 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179041
AA Change: V448A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137331
Gene: ENSMUSG00000072825
AA Change: V448A

DomainStartEndE-ValueType
FHA 22 73 4.65e-10 SMART
low complexity region 370 382 N/A INTRINSIC
low complexity region 535 548 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
Pfam:CEP170_C 832 1510 4.3e-303 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220627
AA Change: V448A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222711
AA Change: V448A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0706 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (95/96)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,378,397 Y3490F Het
Abcc1 T C 16: 14,396,361 V167A probably benign Het
Abcd2 G A 15: 91,188,946 R337C probably damaging Het
Adcy1 A G 11: 7,161,877 D914G probably benign Het
Ahnak G T 19: 9,007,203 L1950F probably damaging Het
Alox5ap T C 5: 149,265,184 probably null Het
Ank C T 15: 27,562,748 H181Y possibly damaging Het
Ankrd44 T A 1: 54,667,521 D592V possibly damaging Het
Ap4m1 T A 5: 138,175,923 N185K possibly damaging Het
Arhgef28 T A 13: 97,945,702 D1199V probably damaging Het
Arnt T C 3: 95,490,380 probably null Het
Atcay C T 10: 81,224,464 V13M probably benign Het
B4galt3 T C 1: 171,271,671 S2P unknown Het
Bicra A T 7: 15,987,812 S593R possibly damaging Het
Brsk2 A C 7: 141,998,678 Q633P probably damaging Het
Cacna1c T A 6: 118,676,319 S909C Het
Ccdc7a G A 8: 129,061,632 T72M probably benign Het
Cct2 A T 10: 117,060,834 F155I possibly damaging Het
Cdv3 G T 9: 103,356,395 P194T probably damaging Het
Cenpc1 A T 5: 86,012,294 V895E probably benign Het
Chil3 G A 3: 106,164,124 R75C possibly damaging Het
Cnfn A T 7: 25,368,444 C24S probably benign Het
Cnga3 A G 1: 37,260,771 K191E possibly damaging Het
Col12a1 A T 9: 79,680,399 Y1153* probably null Het
Coq4 C A 2: 29,795,479 H168Q probably damaging Het
Cyr61 T C 3: 145,648,625 D177G probably benign Het
Dnajc14 G A 10: 128,806,619 V137I probably benign Het
Efr3a T C 15: 65,854,765 L569P probably damaging Het
Epb41l3 A T 17: 69,284,580 E677D probably benign Het
Esp8 G A 17: 40,530,122 M91I unknown Het
Fubp1 A T 3: 152,232,032 probably benign Het
Gldc G T 19: 30,139,379 A391D probably damaging Het
Gm17728 A G 17: 9,422,195 T46A probably benign Het
Gm5798 A G 14: 41,350,646 K112E probably damaging Het
Gm884 A C 11: 103,615,544 I1866S unknown Het
Gpnmb A G 6: 49,052,030 probably benign Het
Grwd1 T C 7: 45,825,874 T415A probably benign Het
Gsdma3 C G 11: 98,631,260 A172G possibly damaging Het
Hltf C T 3: 20,065,402 Q204* probably null Het
Igf1r T G 7: 68,183,463 V457G possibly damaging Het
Inhbc A T 10: 127,357,115 M344K probably damaging Het
Jak3 C T 8: 71,678,516 A60V probably benign Het
Kif13b A G 14: 64,742,433 T511A probably benign Het
Lama2 T A 10: 27,459,388 N97I possibly damaging Het
Limd2 T A 11: 106,158,750 D104V probably damaging Het
Loxl3 T A 6: 83,037,545 C145S probably damaging Het
Lrrc73 A G 17: 46,254,529 N62S probably benign Het
Lrrtm4 A G 6: 80,021,887 D94G probably damaging Het
Lsm3 C A 6: 91,522,270 F86L probably damaging Het
Map10 T C 8: 125,670,552 V228A probably benign Het
Mcidas A C 13: 112,994,130 S54R possibly damaging Het
Me3 T C 7: 89,806,668 Y243H probably damaging Het
Mgat4b A G 11: 50,230,847 T89A possibly damaging Het
Mmp16 T A 4: 18,054,355 probably benign Het
Mtmr9 G A 14: 63,543,777 probably benign Het
Myo1b G T 1: 51,797,039 A331E probably damaging Het
Ncoa6 C T 2: 155,406,468 V1639M possibly damaging Het
Nek9 C T 12: 85,306,346 G752R probably damaging Het
Nufip2 A G 11: 77,693,243 Y661C probably benign Het
Olfr1490 T A 19: 13,654,882 V151E probably damaging Het
Olfr354 C T 2: 36,907,504 A186V possibly damaging Het
Olfr574 A T 7: 102,949,166 I234F probably damaging Het
Olfr828 T C 9: 18,815,696 I199M possibly damaging Het
Olfr972 G A 9: 39,873,598 G108S probably benign Het
Oxct2a A G 4: 123,322,529 L353S probably benign Het
Parvg A G 15: 84,337,800 I243V probably benign Het
Pcdhgb7 C A 18: 37,753,296 N506K possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pgghg G A 7: 140,945,454 probably null Het
Phrf1 G T 7: 141,256,603 G263W unknown Het
Ppfia1 A C 7: 144,479,025 probably null Het
Ppp1r32 T A 19: 10,482,235 Y36F probably damaging Het
Prss37 T A 6: 40,514,963 I228F probably damaging Het
Ptpro A T 6: 137,426,784 K921* probably null Het
Rictor T G 15: 6,783,586 L940R probably damaging Het
Rp1 A G 1: 4,349,960 S310P probably benign Het
Ryr3 A G 2: 112,653,219 V4091A probably damaging Het
Sirt5 T A 13: 43,370,851 M33K possibly damaging Het
Slc25a30 T A 14: 75,771,477 Y90F probably benign Het
St5 T A 7: 109,524,656 K1132M probably damaging Het
Stk11 G A 10: 80,128,435 D388N probably benign Het
Tgm1 C A 14: 55,712,229 R126L probably benign Het
Tmem110 T A 14: 30,866,672 Y119N probably damaging Het
Tmem129 G T 5: 33,654,493 T321N probably benign Het
Tnfrsf11a A T 1: 105,844,518 probably null Het
Tor1aip1 A G 1: 156,031,444 C195R probably benign Het
Tpr A G 1: 150,408,846 E428G possibly damaging Het
Trps1 T A 15: 50,822,373 D802V possibly damaging Het
Usp17lc T A 7: 103,415,109 S6T probably benign Het
Vangl1 C A 3: 102,158,442 R459L Het
Vmn1r43 T C 6: 89,869,955 Y183C probably damaging Het
Vmn2r110 C T 17: 20,574,298 C703Y probably damaging Het
Vmn2r54 T C 7: 12,629,775 Q397R possibly damaging Het
Vmn2r88 T C 14: 51,418,806 V824A probably damaging Het
Vmn2r89 A T 14: 51,455,713 Y79F probably benign Het
Vnn1 T C 10: 23,904,586 S491P probably benign Het
Zbbx A G 3: 75,061,434 F572L unknown Het
Zc3h4 A T 7: 16,435,014 Q1091L unknown Het
Zfp503 C T 14: 21,987,218 V106I possibly damaging Het
Zfp874a T C 13: 67,442,528 T346A probably benign Het
Other mutations in Cep170b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Cep170b APN 12 112735194 missense probably damaging 1.00
IGL01313:Cep170b APN 12 112735652 missense probably damaging 1.00
IGL01317:Cep170b APN 12 112737644 missense probably damaging 1.00
IGL01660:Cep170b APN 12 112744160 missense probably damaging 1.00
IGL02032:Cep170b APN 12 112737333 critical splice donor site probably null
IGL02505:Cep170b APN 12 112743070 missense probably damaging 1.00
IGL02966:Cep170b APN 12 112736444 missense possibly damaging 0.75
IGL03111:Cep170b APN 12 112735179 missense probably damaging 1.00
IGL03367:Cep170b APN 12 112737238 missense probably benign 0.00
R0348:Cep170b UTSW 12 112736806 missense probably damaging 1.00
R0562:Cep170b UTSW 12 112739189 missense probably benign 0.00
R0909:Cep170b UTSW 12 112732039 missense probably null 0.06
R1217:Cep170b UTSW 12 112740905 missense probably damaging 0.99
R1300:Cep170b UTSW 12 112737257 missense probably benign 0.02
R1647:Cep170b UTSW 12 112736372 missense probably damaging 1.00
R1648:Cep170b UTSW 12 112736372 missense probably damaging 1.00
R1652:Cep170b UTSW 12 112733513 missense probably damaging 0.99
R1737:Cep170b UTSW 12 112736627 missense possibly damaging 0.71
R1936:Cep170b UTSW 12 112735738 missense probably damaging 1.00
R1962:Cep170b UTSW 12 112738061 missense probably damaging 1.00
R2094:Cep170b UTSW 12 112735730 missense possibly damaging 0.90
R2208:Cep170b UTSW 12 112738985 missense probably benign 0.00
R3418:Cep170b UTSW 12 112738468 nonsense probably null
R3735:Cep170b UTSW 12 112741004 missense probably damaging 1.00
R3736:Cep170b UTSW 12 112741004 missense probably damaging 1.00
R4299:Cep170b UTSW 12 112739305 missense probably damaging 1.00
R4577:Cep170b UTSW 12 112744718 missense probably damaging 1.00
R5199:Cep170b UTSW 12 112744147 missense probably damaging 1.00
R5512:Cep170b UTSW 12 112733485 missense possibly damaging 0.86
R5575:Cep170b UTSW 12 112735632 missense probably damaging 1.00
R5643:Cep170b UTSW 12 112740841 missense probably benign 0.35
R6074:Cep170b UTSW 12 112744155 missense probably damaging 1.00
R6265:Cep170b UTSW 12 112744559 missense probably damaging 1.00
R6371:Cep170b UTSW 12 112740945 missense probably damaging 1.00
R6376:Cep170b UTSW 12 112732068 missense probably damaging 0.99
R7055:Cep170b UTSW 12 112735715 missense probably damaging 1.00
R7137:Cep170b UTSW 12 112735167 missense probably benign
R7226:Cep170b UTSW 12 112737925 missense possibly damaging 0.80
R7615:Cep170b UTSW 12 112744665 missense probably damaging 1.00
R7831:Cep170b UTSW 12 112744800 missense probably benign 0.08
R8178:Cep170b UTSW 12 112739285 missense possibly damaging 0.92
R8492:Cep170b UTSW 12 112744700 missense probably damaging 1.00
R8838:Cep170b UTSW 12 112743725 missense probably damaging 1.00
R9573:Cep170b UTSW 12 112724720 missense probably damaging 1.00
R9643:Cep170b UTSW 12 112737611 missense probably damaging 1.00
R9694:Cep170b UTSW 12 112735559 missense probably damaging 1.00
R9778:Cep170b UTSW 12 112731430 missense possibly damaging 0.93
R9783:Cep170b UTSW 12 112744684 missense probably damaging 1.00
Z1176:Cep170b UTSW 12 112741012 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGGGACCCTCAAGAGCTG -3'
(R):5'- AGCACTGGAGGTGTCTTCTC -3'

Sequencing Primer
(F):5'- GAGCTGCTGCACAACCAG -3'
(R):5'- AACTGTCCCGCATGCACTG -3'
Posted On 2021-07-15