Incidental Mutation 'R8859:Vmn2r88'
ID 675567
Institutional Source Beutler Lab
Gene Symbol Vmn2r88
Ensembl Gene ENSMUSG00000000606
Gene Name vomeronasal 2, receptor 88
Synonyms V2r13, V2r3
MMRRC Submission 068739-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.154) question?
Stock # R8859 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 51648458-51656984 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 51656263 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 824 (V824A)
Ref Sequence ENSEMBL: ENSMUSP00000125126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]
AlphaFold L7N1W8
Predicted Effect probably benign
Transcript: ENSMUST00000022438
AA Change: V833A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: V833A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 457 8.3e-27 PFAM
Pfam:NCD3G 516 570 1.2e-18 PFAM
Pfam:7tm_3 603 838 1.9e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159674
AA Change: V824A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: V824A

DomainStartEndE-ValueType
Pfam:ANF_receptor 30 408 3.2e-30 PFAM
Pfam:NCD3G 463 516 1.2e-19 PFAM
Pfam:7tm_3 546 785 3.7e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163019
SMART Domains Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606

DomainStartEndE-ValueType
Pfam:ANF_receptor 52 399 3.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228139
AA Change: V825A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (95/96)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,328,397 (GRCm39) Y3490F Het
Abcc1 T C 16: 14,214,225 (GRCm39) V167A probably benign Het
Abcd2 G A 15: 91,073,149 (GRCm39) R337C probably damaging Het
Adcy1 A G 11: 7,111,877 (GRCm39) D914G probably benign Het
Ahnak G T 19: 8,984,567 (GRCm39) L1950F probably damaging Het
Alox5ap T C 5: 149,201,994 (GRCm39) probably null Het
Ank C T 15: 27,562,834 (GRCm39) H181Y possibly damaging Het
Ankrd44 T A 1: 54,706,680 (GRCm39) D592V possibly damaging Het
Ap4m1 T A 5: 138,174,185 (GRCm39) N185K possibly damaging Het
Arhgef28 T A 13: 98,082,210 (GRCm39) D1199V probably damaging Het
Arnt T C 3: 95,397,691 (GRCm39) probably null Het
Atcay C T 10: 81,060,298 (GRCm39) V13M probably benign Het
B4galt3 T C 1: 171,099,241 (GRCm39) S2P unknown Het
Bicra A T 7: 15,721,737 (GRCm39) S593R possibly damaging Het
Brsk2 A C 7: 141,552,415 (GRCm39) Q633P probably damaging Het
Cacna1c T A 6: 118,653,280 (GRCm39) S909C Het
Ccdc7a G A 8: 129,788,113 (GRCm39) T72M probably benign Het
Ccn1 T C 3: 145,354,380 (GRCm39) D177G probably benign Het
Cct2 A T 10: 116,896,739 (GRCm39) F155I possibly damaging Het
Cdv3 G T 9: 103,233,594 (GRCm39) P194T probably damaging Het
Cenpc1 A T 5: 86,160,153 (GRCm39) V895E probably benign Het
Cep170b T C 12: 112,702,881 (GRCm39) V448A probably benign Het
Chil3 G A 3: 106,071,440 (GRCm39) R75C possibly damaging Het
Cnfn A T 7: 25,067,869 (GRCm39) C24S probably benign Het
Cnga3 A G 1: 37,299,852 (GRCm39) K191E possibly damaging Het
Col12a1 A T 9: 79,587,681 (GRCm39) Y1153* probably null Het
Coq4 C A 2: 29,685,491 (GRCm39) H168Q probably damaging Het
Dennd2b T A 7: 109,123,863 (GRCm39) K1132M probably damaging Het
Dnajc14 G A 10: 128,642,488 (GRCm39) V137I probably benign Het
Efr3a T C 15: 65,726,614 (GRCm39) L569P probably damaging Het
Epb41l3 A T 17: 69,591,575 (GRCm39) E677D probably benign Het
Esp8 G A 17: 40,841,013 (GRCm39) M91I unknown Het
Fubp1 A T 3: 151,937,669 (GRCm39) probably benign Het
Gldc G T 19: 30,116,779 (GRCm39) A391D probably damaging Het
Gm17728 A G 17: 9,641,027 (GRCm39) T46A probably benign Het
Gm5798 A G 14: 41,072,603 (GRCm39) K112E probably damaging Het
Gpnmb A G 6: 49,028,964 (GRCm39) probably benign Het
Grwd1 T C 7: 45,475,298 (GRCm39) T415A probably benign Het
Gsdma3 C G 11: 98,522,086 (GRCm39) A172G possibly damaging Het
Hltf C T 3: 20,119,566 (GRCm39) Q204* probably null Het
Igf1r T G 7: 67,833,211 (GRCm39) V457G possibly damaging Het
Inhbc A T 10: 127,192,984 (GRCm39) M344K probably damaging Het
Jak3 C T 8: 72,131,160 (GRCm39) A60V probably benign Het
Kif13b A G 14: 64,979,882 (GRCm39) T511A probably benign Het
Lama2 T A 10: 27,335,384 (GRCm39) N97I possibly damaging Het
Limd2 T A 11: 106,049,576 (GRCm39) D104V probably damaging Het
Loxl3 T A 6: 83,014,526 (GRCm39) C145S probably damaging Het
Lrrc37 A C 11: 103,506,370 (GRCm39) I1866S unknown Het
Lrrc73 A G 17: 46,565,455 (GRCm39) N62S probably benign Het
Lrrtm4 A G 6: 79,998,870 (GRCm39) D94G probably damaging Het
Lsm3 C A 6: 91,499,252 (GRCm39) F86L probably damaging Het
Map10 T C 8: 126,397,291 (GRCm39) V228A probably benign Het
Mcidas A C 13: 113,130,664 (GRCm39) S54R possibly damaging Het
Me3 T C 7: 89,455,876 (GRCm39) Y243H probably damaging Het
Mgat4b A G 11: 50,121,674 (GRCm39) T89A possibly damaging Het
Mmp16 T A 4: 18,054,355 (GRCm39) probably benign Het
Mtmr9 G A 14: 63,781,226 (GRCm39) probably benign Het
Myo1b G T 1: 51,836,198 (GRCm39) A331E probably damaging Het
Ncoa6 C T 2: 155,248,388 (GRCm39) V1639M possibly damaging Het
Nek9 C T 12: 85,353,120 (GRCm39) G752R probably damaging Het
Nufip2 A G 11: 77,584,069 (GRCm39) Y661C probably benign Het
Or10w1 T A 19: 13,632,246 (GRCm39) V151E probably damaging Het
Or1n2 C T 2: 36,797,516 (GRCm39) A186V possibly damaging Het
Or51t4 A T 7: 102,598,373 (GRCm39) I234F probably damaging Het
Or7g16 T C 9: 18,726,992 (GRCm39) I199M possibly damaging Het
Or8g55 G A 9: 39,784,894 (GRCm39) G108S probably benign Het
Oxct2a A G 4: 123,216,322 (GRCm39) L353S probably benign Het
Parvg A G 15: 84,222,001 (GRCm39) I243V probably benign Het
Pcdhgb7 C A 18: 37,886,349 (GRCm39) N506K possibly damaging Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Pgghg G A 7: 140,525,367 (GRCm39) probably null Het
Phrf1 G T 7: 140,836,516 (GRCm39) G263W unknown Het
Ppfia1 A C 7: 144,032,762 (GRCm39) probably null Het
Prss37 T A 6: 40,491,897 (GRCm39) I228F probably damaging Het
Ptpro A T 6: 137,403,782 (GRCm39) K921* probably null Het
Rictor T G 15: 6,813,067 (GRCm39) L940R probably damaging Het
Rp1 A G 1: 4,420,183 (GRCm39) S310P probably benign Het
Ryr3 A G 2: 112,483,564 (GRCm39) V4091A probably damaging Het
Saxo4 T A 19: 10,459,599 (GRCm39) Y36F probably damaging Het
Sirt5 T A 13: 43,524,327 (GRCm39) M33K possibly damaging Het
Slc25a30 T A 14: 76,008,917 (GRCm39) Y90F probably benign Het
Stimate T A 14: 30,588,629 (GRCm39) Y119N probably damaging Het
Stk11 G A 10: 79,964,269 (GRCm39) D388N probably benign Het
Tgm1 C A 14: 55,949,686 (GRCm39) R126L probably benign Het
Tmem129 G T 5: 33,811,837 (GRCm39) T321N probably benign Het
Tnfrsf11a A T 1: 105,772,244 (GRCm39) probably null Het
Tor1aip1 A G 1: 155,907,190 (GRCm39) C195R probably benign Het
Tpr A G 1: 150,284,597 (GRCm39) E428G possibly damaging Het
Trps1 T A 15: 50,685,769 (GRCm39) D802V possibly damaging Het
Usp17lc T A 7: 103,064,316 (GRCm39) S6T probably benign Het
Vangl1 C A 3: 102,065,758 (GRCm39) R459L Het
Vmn1r43 T C 6: 89,846,937 (GRCm39) Y183C probably damaging Het
Vmn2r110 C T 17: 20,794,560 (GRCm39) C703Y probably damaging Het
Vmn2r54 T C 7: 12,363,702 (GRCm39) Q397R possibly damaging Het
Vmn2r89 A T 14: 51,693,170 (GRCm39) Y79F probably benign Het
Vnn1 T C 10: 23,780,484 (GRCm39) S491P probably benign Het
Zbbx A G 3: 74,968,741 (GRCm39) F572L unknown Het
Zc3h4 A T 7: 16,168,939 (GRCm39) Q1091L unknown Het
Zfp503 C T 14: 22,037,286 (GRCm39) V106I possibly damaging Het
Zfp874a T C 13: 67,590,647 (GRCm39) T346A probably benign Het
Other mutations in Vmn2r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r88 APN 14 51,650,713 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,650,517 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,650,582 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,654,259 (GRCm39) missense possibly damaging 0.59
IGL02308:Vmn2r88 APN 14 51,655,437 (GRCm39) missense possibly damaging 0.96
IGL02481:Vmn2r88 APN 14 51,651,611 (GRCm39) missense probably benign
IGL02483:Vmn2r88 APN 14 51,651,611 (GRCm39) missense probably benign
IGL03241:Vmn2r88 APN 14 51,655,830 (GRCm39) missense probably benign 0.03
R0052:Vmn2r88 UTSW 14 51,656,157 (GRCm39) missense possibly damaging 0.88
R0070:Vmn2r88 UTSW 14 51,651,597 (GRCm39) missense probably benign 0.08
R0799:Vmn2r88 UTSW 14 51,651,959 (GRCm39) missense possibly damaging 0.61
R0906:Vmn2r88 UTSW 14 51,655,666 (GRCm39) missense probably damaging 1.00
R1322:Vmn2r88 UTSW 14 51,651,565 (GRCm39) missense probably damaging 1.00
R1352:Vmn2r88 UTSW 14 51,656,007 (GRCm39) missense probably damaging 1.00
R1639:Vmn2r88 UTSW 14 51,654,244 (GRCm39) missense probably damaging 0.98
R1780:Vmn2r88 UTSW 14 51,656,029 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r88 UTSW 14 51,650,487 (GRCm39) splice site probably benign
R1911:Vmn2r88 UTSW 14 51,655,671 (GRCm39) missense probably damaging 1.00
R2113:Vmn2r88 UTSW 14 51,655,651 (GRCm39) missense probably damaging 1.00
R2120:Vmn2r88 UTSW 14 51,650,665 (GRCm39) missense probably benign 0.00
R2126:Vmn2r88 UTSW 14 51,651,264 (GRCm39) missense probably benign 0.01
R2348:Vmn2r88 UTSW 14 51,651,461 (GRCm39) missense probably benign 0.00
R2881:Vmn2r88 UTSW 14 51,656,146 (GRCm39) missense probably damaging 0.97
R2884:Vmn2r88 UTSW 14 51,651,391 (GRCm39) missense probably damaging 1.00
R3081:Vmn2r88 UTSW 14 51,656,089 (GRCm39) missense probably damaging 0.99
R3933:Vmn2r88 UTSW 14 51,651,435 (GRCm39) missense probably benign 0.44
R3967:Vmn2r88 UTSW 14 51,650,647 (GRCm39) missense probably benign 0.06
R4091:Vmn2r88 UTSW 14 51,652,883 (GRCm39) missense probably damaging 1.00
R4378:Vmn2r88 UTSW 14 51,650,746 (GRCm39) nonsense probably null
R4397:Vmn2r88 UTSW 14 51,655,435 (GRCm39) missense probably damaging 1.00
R4418:Vmn2r88 UTSW 14 51,655,538 (GRCm39) missense probably damaging 1.00
R4609:Vmn2r88 UTSW 14 51,655,531 (GRCm39) missense probably damaging 0.98
R4647:Vmn2r88 UTSW 14 51,656,250 (GRCm39) missense probably benign 0.02
R4672:Vmn2r88 UTSW 14 51,655,612 (GRCm39) missense probably damaging 1.00
R4684:Vmn2r88 UTSW 14 51,650,791 (GRCm39) missense possibly damaging 0.95
R4686:Vmn2r88 UTSW 14 51,650,796 (GRCm39) missense probably benign 0.03
R4720:Vmn2r88 UTSW 14 51,650,702 (GRCm39) missense probably benign 0.01
R5046:Vmn2r88 UTSW 14 51,650,638 (GRCm39) missense probably benign 0.03
R5063:Vmn2r88 UTSW 14 51,648,603 (GRCm39) missense probably damaging 0.96
R5619:Vmn2r88 UTSW 14 51,651,367 (GRCm39) missense probably damaging 0.99
R5652:Vmn2r88 UTSW 14 51,656,029 (GRCm39) missense probably damaging 0.98
R6020:Vmn2r88 UTSW 14 51,655,606 (GRCm39) nonsense probably null
R6103:Vmn2r88 UTSW 14 51,652,826 (GRCm39) missense probably benign 0.17
R6674:Vmn2r88 UTSW 14 51,651,795 (GRCm39) missense probably benign 0.01
R6799:Vmn2r88 UTSW 14 51,651,426 (GRCm39) missense probably benign 0.05
R7089:Vmn2r88 UTSW 14 51,656,100 (GRCm39) missense
R7104:Vmn2r88 UTSW 14 51,651,253 (GRCm39) missense
R7265:Vmn2r88 UTSW 14 51,655,776 (GRCm39) missense
R7316:Vmn2r88 UTSW 14 51,651,712 (GRCm39) missense
R7552:Vmn2r88 UTSW 14 51,648,315 (GRCm39) splice site probably null
R7611:Vmn2r88 UTSW 14 51,651,454 (GRCm39) missense
R7667:Vmn2r88 UTSW 14 51,655,446 (GRCm39) missense
R7682:Vmn2r88 UTSW 14 51,655,906 (GRCm39) missense
R7755:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R7811:Vmn2r88 UTSW 14 51,656,160 (GRCm39) missense
R7882:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R7957:Vmn2r88 UTSW 14 51,650,589 (GRCm39) missense
R7998:Vmn2r88 UTSW 14 51,651,565 (GRCm39) missense
R8142:Vmn2r88 UTSW 14 51,651,564 (GRCm39) missense
R8186:Vmn2r88 UTSW 14 51,656,157 (GRCm39) missense
R8348:Vmn2r88 UTSW 14 51,656,253 (GRCm39) missense probably damaging 0.97
R8448:Vmn2r88 UTSW 14 51,656,253 (GRCm39) missense probably damaging 0.97
R8483:Vmn2r88 UTSW 14 51,650,530 (GRCm39) missense possibly damaging 0.48
R8783:Vmn2r88 UTSW 14 51,651,523 (GRCm39) missense
R8916:Vmn2r88 UTSW 14 51,648,593 (GRCm39) missense
R8936:Vmn2r88 UTSW 14 51,655,983 (GRCm39) missense possibly damaging 0.88
R9004:Vmn2r88 UTSW 14 51,650,624 (GRCm39) missense
R9038:Vmn2r88 UTSW 14 51,651,490 (GRCm39) missense
R9063:Vmn2r88 UTSW 14 51,648,329 (GRCm39) start gained probably benign
R9311:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R9382:Vmn2r88 UTSW 14 51,656,197 (GRCm39) missense
R9483:Vmn2r88 UTSW 14 51,648,641 (GRCm39) missense
R9602:Vmn2r88 UTSW 14 51,651,189 (GRCm39) missense
V5622:Vmn2r88 UTSW 14 51,650,584 (GRCm39) missense probably benign
X0024:Vmn2r88 UTSW 14 51,651,289 (GRCm39) missense possibly damaging 0.79
X0025:Vmn2r88 UTSW 14 51,654,259 (GRCm39) missense possibly damaging 0.59
Z1177:Vmn2r88 UTSW 14 51,655,644 (GRCm39) missense
Z1177:Vmn2r88 UTSW 14 51,655,503 (GRCm39) frame shift probably null
Z1190:Vmn2r88 UTSW 14 51,650,658 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GCTTTCTTGGCTAGGAACCTTC -3'
(R):5'- CAATAGACAGTTCTGTCCTGTTTG -3'

Sequencing Primer
(F):5'- GGAACCTTCCTGACACATTCAATG -3'
(R):5'- ACAGTTCTGTCCTGTTTGTAAGTTC -3'
Posted On 2021-07-15