Incidental Mutation 'R8859:Ank'
ID 675573
Institutional Source Beutler Lab
Gene Symbol Ank
Ensembl Gene ENSMUSG00000022265
Gene Name progressive ankylosis
Synonyms D15Ertd221e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.346) question?
Stock # R8859 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 27466677-27594909 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 27562748 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 181 (H181Y)
Ref Sequence ENSEMBL: ENSMUSP00000022875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022875] [ENSMUST00000228179]
AlphaFold Q9JHZ2
Predicted Effect possibly damaging
Transcript: ENSMUST00000022875
AA Change: H181Y

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022875
Gene: ENSMUSG00000022265
AA Change: H181Y

DomainStartEndE-ValueType
Pfam:ANKH 1 345 1e-223 PFAM
transmembrane domain 361 383 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228179
Meta Mutation Damage Score 0.1094 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass transmembrane protein that is expressed in joints and other tissues and controls pyrophosphate levels in cultured cells. Progressive ankylosis-mediated control of pyrophosphate levels has been suggested as a possible mechanism regulating tissue calcification and susceptibility to arthritis in higher animals. Mutations in this gene have been associated with autosomal dominant craniometaphyseal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals exhibit joint stiffness due to increased calcium deposits in calcified cartilages and die prematurely. Hyperostosis of craniofacial bones and the mandible has been reported in other mutants as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,378,397 Y3490F Het
Abcc1 T C 16: 14,396,361 V167A probably benign Het
Abcd2 G A 15: 91,188,946 R337C probably damaging Het
Adcy1 A G 11: 7,161,877 D914G probably benign Het
Ahnak G T 19: 9,007,203 L1950F probably damaging Het
Alox5ap T C 5: 149,265,184 probably null Het
Ankrd44 T A 1: 54,667,521 D592V possibly damaging Het
Ap4m1 T A 5: 138,175,923 N185K possibly damaging Het
Arhgef28 T A 13: 97,945,702 D1199V probably damaging Het
Arnt T C 3: 95,490,380 probably null Het
Atcay C T 10: 81,224,464 V13M probably benign Het
B4galt3 T C 1: 171,271,671 S2P unknown Het
Bicra A T 7: 15,987,812 S593R possibly damaging Het
Brsk2 A C 7: 141,998,678 Q633P probably damaging Het
Cacna1c T A 6: 118,676,319 S909C Het
Ccdc7a G A 8: 129,061,632 T72M probably benign Het
Cct2 A T 10: 117,060,834 F155I possibly damaging Het
Cdv3 G T 9: 103,356,395 P194T probably damaging Het
Cenpc1 A T 5: 86,012,294 V895E probably benign Het
Cep170b T C 12: 112,736,447 V448A probably benign Het
Chil3 G A 3: 106,164,124 R75C possibly damaging Het
Cnfn A T 7: 25,368,444 C24S probably benign Het
Cnga3 A G 1: 37,260,771 K191E possibly damaging Het
Col12a1 A T 9: 79,680,399 Y1153* probably null Het
Coq4 C A 2: 29,795,479 H168Q probably damaging Het
Cyr61 T C 3: 145,648,625 D177G probably benign Het
Dnajc14 G A 10: 128,806,619 V137I probably benign Het
Efr3a T C 15: 65,854,765 L569P probably damaging Het
Epb41l3 A T 17: 69,284,580 E677D probably benign Het
Esp8 G A 17: 40,530,122 M91I unknown Het
Fubp1 A T 3: 152,232,032 probably benign Het
Gldc G T 19: 30,139,379 A391D probably damaging Het
Gm17728 A G 17: 9,422,195 T46A probably benign Het
Gm5798 A G 14: 41,350,646 K112E probably damaging Het
Gm884 A C 11: 103,615,544 I1866S unknown Het
Gpnmb A G 6: 49,052,030 probably benign Het
Grwd1 T C 7: 45,825,874 T415A probably benign Het
Gsdma3 C G 11: 98,631,260 A172G possibly damaging Het
Hltf C T 3: 20,065,402 Q204* probably null Het
Igf1r T G 7: 68,183,463 V457G possibly damaging Het
Inhbc A T 10: 127,357,115 M344K probably damaging Het
Jak3 C T 8: 71,678,516 A60V probably benign Het
Kif13b A G 14: 64,742,433 T511A probably benign Het
Lama2 T A 10: 27,459,388 N97I possibly damaging Het
Limd2 T A 11: 106,158,750 D104V probably damaging Het
Loxl3 T A 6: 83,037,545 C145S probably damaging Het
Lrrc73 A G 17: 46,254,529 N62S probably benign Het
Lrrtm4 A G 6: 80,021,887 D94G probably damaging Het
Lsm3 C A 6: 91,522,270 F86L probably damaging Het
Map10 T C 8: 125,670,552 V228A probably benign Het
Mcidas A C 13: 112,994,130 S54R possibly damaging Het
Me3 T C 7: 89,806,668 Y243H probably damaging Het
Mgat4b A G 11: 50,230,847 T89A possibly damaging Het
Mmp16 T A 4: 18,054,355 probably benign Het
Mtmr9 G A 14: 63,543,777 probably benign Het
Myo1b G T 1: 51,797,039 A331E probably damaging Het
Ncoa6 C T 2: 155,406,468 V1639M possibly damaging Het
Nek9 C T 12: 85,306,346 G752R probably damaging Het
Nufip2 A G 11: 77,693,243 Y661C probably benign Het
Olfr1490 T A 19: 13,654,882 V151E probably damaging Het
Olfr354 C T 2: 36,907,504 A186V possibly damaging Het
Olfr574 A T 7: 102,949,166 I234F probably damaging Het
Olfr828 T C 9: 18,815,696 I199M possibly damaging Het
Olfr972 G A 9: 39,873,598 G108S probably benign Het
Oxct2a A G 4: 123,322,529 L353S probably benign Het
Parvg A G 15: 84,337,800 I243V probably benign Het
Pcdhgb7 C A 18: 37,753,296 N506K possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pgghg G A 7: 140,945,454 probably null Het
Phrf1 G T 7: 141,256,603 G263W unknown Het
Ppfia1 A C 7: 144,479,025 probably null Het
Ppp1r32 T A 19: 10,482,235 Y36F probably damaging Het
Prss37 T A 6: 40,514,963 I228F probably damaging Het
Ptpro A T 6: 137,426,784 K921* probably null Het
Rictor T G 15: 6,783,586 L940R probably damaging Het
Rp1 A G 1: 4,349,960 S310P probably benign Het
Ryr3 A G 2: 112,653,219 V4091A probably damaging Het
Sirt5 T A 13: 43,370,851 M33K possibly damaging Het
Slc25a30 T A 14: 75,771,477 Y90F probably benign Het
St5 T A 7: 109,524,656 K1132M probably damaging Het
Stk11 G A 10: 80,128,435 D388N probably benign Het
Tgm1 C A 14: 55,712,229 R126L probably benign Het
Tmem110 T A 14: 30,866,672 Y119N probably damaging Het
Tmem129 G T 5: 33,654,493 T321N probably benign Het
Tnfrsf11a A T 1: 105,844,518 probably null Het
Tor1aip1 A G 1: 156,031,444 C195R probably benign Het
Tpr A G 1: 150,408,846 E428G possibly damaging Het
Trps1 T A 15: 50,822,373 D802V possibly damaging Het
Usp17lc T A 7: 103,415,109 S6T probably benign Het
Vangl1 C A 3: 102,158,442 R459L Het
Vmn1r43 T C 6: 89,869,955 Y183C probably damaging Het
Vmn2r110 C T 17: 20,574,298 C703Y probably damaging Het
Vmn2r54 T C 7: 12,629,775 Q397R possibly damaging Het
Vmn2r88 T C 14: 51,418,806 V824A probably damaging Het
Vmn2r89 A T 14: 51,455,713 Y79F probably benign Het
Vnn1 T C 10: 23,904,586 S491P probably benign Het
Zbbx A G 3: 75,061,434 F572L unknown Het
Zc3h4 A T 7: 16,435,014 Q1091L unknown Het
Zfp503 C T 14: 21,987,218 V106I possibly damaging Het
Zfp874a T C 13: 67,442,528 T346A probably benign Het
Other mutations in Ank
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Ank APN 15 27544351 missense possibly damaging 0.53
IGL02975:Ank APN 15 27467001 utr 5 prime probably benign
R0309:Ank UTSW 15 27567572 missense possibly damaging 0.65
R0470:Ank UTSW 15 27571635 missense probably damaging 0.98
R1688:Ank UTSW 15 27557234 missense probably damaging 1.00
R1691:Ank UTSW 15 27590944 missense probably damaging 1.00
R2073:Ank UTSW 15 27565022 missense probably benign 0.20
R2248:Ank UTSW 15 27562711 splice site probably null
R3113:Ank UTSW 15 27571614 missense probably damaging 1.00
R4027:Ank UTSW 15 27544257 missense probably damaging 1.00
R4028:Ank UTSW 15 27544257 missense probably damaging 1.00
R4029:Ank UTSW 15 27544257 missense probably damaging 1.00
R4030:Ank UTSW 15 27544257 missense probably damaging 1.00
R4124:Ank UTSW 15 27571623 missense probably damaging 1.00
R4126:Ank UTSW 15 27590373 missense probably benign
R4508:Ank UTSW 15 27564977 missense probably damaging 1.00
R4517:Ank UTSW 15 27562749 missense possibly damaging 0.51
R4631:Ank UTSW 15 27467090 missense probably benign
R4653:Ank UTSW 15 27590361 missense probably null 0.98
R5001:Ank UTSW 15 27562733 missense probably damaging 0.99
R5029:Ank UTSW 15 27590353 missense probably benign 0.00
R5475:Ank UTSW 15 27557199 missense probably damaging 1.00
R7218:Ank UTSW 15 27544321 missense probably damaging 1.00
R7234:Ank UTSW 15 27571656 critical splice donor site probably null
R8530:Ank UTSW 15 27544404 missense probably benign
R8935:Ank UTSW 15 27591026 missense probably damaging 0.99
R9002:Ank UTSW 15 27544327 nonsense probably null
R9408:Ank UTSW 15 27591502 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCACTGCCTTAAAAGACTC -3'
(R):5'- CCAGAAAGTCAAACGGTGC -3'

Sequencing Primer
(F):5'- AGAACCATGGCTGCGATC -3'
(R):5'- ATGTTCCTGTAGTAGCCC -3'
Posted On 2021-07-15