Incidental Mutation 'R8859:Gldc'
ID 675588
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission 068739-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8859 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 30116779 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 391 (A391D)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect probably damaging
Transcript: ENSMUST00000025778
AA Change: A391D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: A391D

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,328,397 (GRCm39) Y3490F Het
Abcc1 T C 16: 14,214,225 (GRCm39) V167A probably benign Het
Abcd2 G A 15: 91,073,149 (GRCm39) R337C probably damaging Het
Adcy1 A G 11: 7,111,877 (GRCm39) D914G probably benign Het
Ahnak G T 19: 8,984,567 (GRCm39) L1950F probably damaging Het
Alox5ap T C 5: 149,201,994 (GRCm39) probably null Het
Ank C T 15: 27,562,834 (GRCm39) H181Y possibly damaging Het
Ankrd44 T A 1: 54,706,680 (GRCm39) D592V possibly damaging Het
Ap4m1 T A 5: 138,174,185 (GRCm39) N185K possibly damaging Het
Arhgef28 T A 13: 98,082,210 (GRCm39) D1199V probably damaging Het
Arnt T C 3: 95,397,691 (GRCm39) probably null Het
Atcay C T 10: 81,060,298 (GRCm39) V13M probably benign Het
B4galt3 T C 1: 171,099,241 (GRCm39) S2P unknown Het
Bicra A T 7: 15,721,737 (GRCm39) S593R possibly damaging Het
Brsk2 A C 7: 141,552,415 (GRCm39) Q633P probably damaging Het
Cacna1c T A 6: 118,653,280 (GRCm39) S909C Het
Ccdc7a G A 8: 129,788,113 (GRCm39) T72M probably benign Het
Ccn1 T C 3: 145,354,380 (GRCm39) D177G probably benign Het
Cct2 A T 10: 116,896,739 (GRCm39) F155I possibly damaging Het
Cdv3 G T 9: 103,233,594 (GRCm39) P194T probably damaging Het
Cenpc1 A T 5: 86,160,153 (GRCm39) V895E probably benign Het
Cep170b T C 12: 112,702,881 (GRCm39) V448A probably benign Het
Chil3 G A 3: 106,071,440 (GRCm39) R75C possibly damaging Het
Cnfn A T 7: 25,067,869 (GRCm39) C24S probably benign Het
Cnga3 A G 1: 37,299,852 (GRCm39) K191E possibly damaging Het
Col12a1 A T 9: 79,587,681 (GRCm39) Y1153* probably null Het
Coq4 C A 2: 29,685,491 (GRCm39) H168Q probably damaging Het
Dennd2b T A 7: 109,123,863 (GRCm39) K1132M probably damaging Het
Dnajc14 G A 10: 128,642,488 (GRCm39) V137I probably benign Het
Efr3a T C 15: 65,726,614 (GRCm39) L569P probably damaging Het
Epb41l3 A T 17: 69,591,575 (GRCm39) E677D probably benign Het
Esp8 G A 17: 40,841,013 (GRCm39) M91I unknown Het
Fubp1 A T 3: 151,937,669 (GRCm39) probably benign Het
Gm17728 A G 17: 9,641,027 (GRCm39) T46A probably benign Het
Gm5798 A G 14: 41,072,603 (GRCm39) K112E probably damaging Het
Gpnmb A G 6: 49,028,964 (GRCm39) probably benign Het
Grwd1 T C 7: 45,475,298 (GRCm39) T415A probably benign Het
Gsdma3 C G 11: 98,522,086 (GRCm39) A172G possibly damaging Het
Hltf C T 3: 20,119,566 (GRCm39) Q204* probably null Het
Igf1r T G 7: 67,833,211 (GRCm39) V457G possibly damaging Het
Inhbc A T 10: 127,192,984 (GRCm39) M344K probably damaging Het
Jak3 C T 8: 72,131,160 (GRCm39) A60V probably benign Het
Kif13b A G 14: 64,979,882 (GRCm39) T511A probably benign Het
Lama2 T A 10: 27,335,384 (GRCm39) N97I possibly damaging Het
Limd2 T A 11: 106,049,576 (GRCm39) D104V probably damaging Het
Loxl3 T A 6: 83,014,526 (GRCm39) C145S probably damaging Het
Lrrc37 A C 11: 103,506,370 (GRCm39) I1866S unknown Het
Lrrc73 A G 17: 46,565,455 (GRCm39) N62S probably benign Het
Lrrtm4 A G 6: 79,998,870 (GRCm39) D94G probably damaging Het
Lsm3 C A 6: 91,499,252 (GRCm39) F86L probably damaging Het
Map10 T C 8: 126,397,291 (GRCm39) V228A probably benign Het
Mcidas A C 13: 113,130,664 (GRCm39) S54R possibly damaging Het
Me3 T C 7: 89,455,876 (GRCm39) Y243H probably damaging Het
Mgat4b A G 11: 50,121,674 (GRCm39) T89A possibly damaging Het
Mmp16 T A 4: 18,054,355 (GRCm39) probably benign Het
Mtmr9 G A 14: 63,781,226 (GRCm39) probably benign Het
Myo1b G T 1: 51,836,198 (GRCm39) A331E probably damaging Het
Ncoa6 C T 2: 155,248,388 (GRCm39) V1639M possibly damaging Het
Nek9 C T 12: 85,353,120 (GRCm39) G752R probably damaging Het
Nufip2 A G 11: 77,584,069 (GRCm39) Y661C probably benign Het
Or10w1 T A 19: 13,632,246 (GRCm39) V151E probably damaging Het
Or1n2 C T 2: 36,797,516 (GRCm39) A186V possibly damaging Het
Or51t4 A T 7: 102,598,373 (GRCm39) I234F probably damaging Het
Or7g16 T C 9: 18,726,992 (GRCm39) I199M possibly damaging Het
Or8g55 G A 9: 39,784,894 (GRCm39) G108S probably benign Het
Oxct2a A G 4: 123,216,322 (GRCm39) L353S probably benign Het
Parvg A G 15: 84,222,001 (GRCm39) I243V probably benign Het
Pcdhgb7 C A 18: 37,886,349 (GRCm39) N506K possibly damaging Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Pgghg G A 7: 140,525,367 (GRCm39) probably null Het
Phrf1 G T 7: 140,836,516 (GRCm39) G263W unknown Het
Ppfia1 A C 7: 144,032,762 (GRCm39) probably null Het
Prss37 T A 6: 40,491,897 (GRCm39) I228F probably damaging Het
Ptpro A T 6: 137,403,782 (GRCm39) K921* probably null Het
Rictor T G 15: 6,813,067 (GRCm39) L940R probably damaging Het
Rp1 A G 1: 4,420,183 (GRCm39) S310P probably benign Het
Ryr3 A G 2: 112,483,564 (GRCm39) V4091A probably damaging Het
Saxo4 T A 19: 10,459,599 (GRCm39) Y36F probably damaging Het
Sirt5 T A 13: 43,524,327 (GRCm39) M33K possibly damaging Het
Slc25a30 T A 14: 76,008,917 (GRCm39) Y90F probably benign Het
Stimate T A 14: 30,588,629 (GRCm39) Y119N probably damaging Het
Stk11 G A 10: 79,964,269 (GRCm39) D388N probably benign Het
Tgm1 C A 14: 55,949,686 (GRCm39) R126L probably benign Het
Tmem129 G T 5: 33,811,837 (GRCm39) T321N probably benign Het
Tnfrsf11a A T 1: 105,772,244 (GRCm39) probably null Het
Tor1aip1 A G 1: 155,907,190 (GRCm39) C195R probably benign Het
Tpr A G 1: 150,284,597 (GRCm39) E428G possibly damaging Het
Trps1 T A 15: 50,685,769 (GRCm39) D802V possibly damaging Het
Usp17lc T A 7: 103,064,316 (GRCm39) S6T probably benign Het
Vangl1 C A 3: 102,065,758 (GRCm39) R459L Het
Vmn1r43 T C 6: 89,846,937 (GRCm39) Y183C probably damaging Het
Vmn2r110 C T 17: 20,794,560 (GRCm39) C703Y probably damaging Het
Vmn2r54 T C 7: 12,363,702 (GRCm39) Q397R possibly damaging Het
Vmn2r88 T C 14: 51,656,263 (GRCm39) V824A probably damaging Het
Vmn2r89 A T 14: 51,693,170 (GRCm39) Y79F probably benign Het
Vnn1 T C 10: 23,780,484 (GRCm39) S491P probably benign Het
Zbbx A G 3: 74,968,741 (GRCm39) F572L unknown Het
Zc3h4 A T 7: 16,168,939 (GRCm39) Q1091L unknown Het
Zfp503 C T 14: 22,037,286 (GRCm39) V106I possibly damaging Het
Zfp874a T C 13: 67,590,647 (GRCm39) T346A probably benign Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1085:Gldc UTSW 19 30,128,828 (GRCm39) missense probably damaging 1.00
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1593:Gldc UTSW 19 30,091,150 (GRCm39) missense probably damaging 1.00
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3836:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5718:Gldc UTSW 19 30,088,172 (GRCm39) nonsense probably null
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6777:Gldc UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
R6865:Gldc UTSW 19 30,111,162 (GRCm39) missense possibly damaging 0.92
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R7647:Gldc UTSW 19 30,096,067 (GRCm39) missense probably damaging 0.96
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8321:Gldc UTSW 19 30,120,807 (GRCm39) nonsense probably null
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8503:Gldc UTSW 19 30,077,254 (GRCm39) missense probably benign 0.26
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8785:Gldc UTSW 19 30,092,634 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8820:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8887:Gldc UTSW 19 30,111,156 (GRCm39) missense possibly damaging 0.94
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R8940:Gldc UTSW 19 30,128,884 (GRCm39) missense probably benign
R9070:Gldc UTSW 19 30,080,404 (GRCm39) missense probably damaging 1.00
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9144:Gldc UTSW 19 30,114,593 (GRCm39) missense
R9163:Gldc UTSW 19 30,111,686 (GRCm39) missense probably benign 0.13
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGTCTGCCTGTCACACTG -3'
(R):5'- AAGCGTTGTTCTCCCTCAGG -3'

Sequencing Primer
(F):5'- CTGTCATCGATACTGAAAATACTGCC -3'
(R):5'- GTTCTCCCTCAGGCTATATAAGTGG -3'
Posted On 2021-07-15