Incidental Mutation 'R8860:Atf6'
ID 675592
Institutional Source Beutler Lab
Gene Symbol Atf6
Ensembl Gene ENSMUSG00000026663
Gene Name activating transcription factor 6
Synonyms 9130025P16Rik, ESTM49, Atf6alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock # R8860 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 170704674-170867771 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 170852966 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 52 (F52L)
Ref Sequence ENSEMBL: ENSMUSP00000027974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027974]
AlphaFold F6VAN0
Predicted Effect probably null
Transcript: ENSMUST00000027974
AA Change: F52L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: F52L

DomainStartEndE-ValueType
low complexity region 78 101 N/A INTRINSIC
low complexity region 109 121 N/A INTRINSIC
low complexity region 168 178 N/A INTRINSIC
BRLZ 291 355 2.72e-16 SMART
Blast:BRLZ 384 419 5e-6 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 631 650 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T G 12: 71,184,423 V985G possibly damaging Het
Acr T G 15: 89,573,854 M246R probably damaging Het
Ago4 A T 4: 126,493,250 D853E probably benign Het
Blm A T 7: 80,494,528 C782S probably benign Het
C2cd5 A G 6: 143,083,220 Y98H probably benign Het
Ccdc106 A G 7: 5,059,571 D192G probably benign Het
Celf2 A G 2: 6,560,657 probably null Het
Chd1l A G 3: 97,570,369 F690S probably benign Het
Chuk A G 19: 44,087,968 S435P possibly damaging Het
Cisd3 T A 11: 97,685,877 S10T probably benign Het
Cma2 G T 14: 55,973,117 C143F probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Cnppd1 A G 1: 75,136,419 S402P probably damaging Het
Crtc1 A G 8: 70,388,155 S474P probably damaging Het
Dhx38 A T 8: 109,562,729 L13* probably null Het
Fat4 A T 3: 38,892,120 T1721S probably benign Het
Fntb T A 12: 76,888,052 V201E possibly damaging Het
Gga3 T C 11: 115,590,418 D242G probably benign Het
Hif3a A T 7: 17,040,987 M562K probably benign Het
Hnrnpc A G 14: 52,075,335 S261P possibly damaging Het
Intu G A 3: 40,672,732 M314I probably benign Het
Lims1 C T 10: 58,408,103 Q126* probably null Het
Lrrc14b T A 13: 74,361,289 D333V probably damaging Het
Meaf6 T A 4: 125,086,197 L48Q probably damaging Het
Miip T A 4: 147,866,382 probably benign Het
Myh4 T A 11: 67,241,509 I155N probably damaging Het
Nnt T C 13: 119,339,871 Y733C Het
Nup155 T C 15: 8,130,156 V517A possibly damaging Het
Obscn C T 11: 59,007,614 R6607Q unknown Het
Olfr320 C T 11: 58,684,140 T89I probably benign Het
Olfr571 A G 7: 102,909,129 S237P probably benign Het
Ptprg T C 14: 12,213,685 Y1018H probably damaging Het
Rdh8 A C 9: 20,822,725 N69T probably benign Het
Rgsl1 G A 1: 153,821,354 Q572* probably null Het
Sept7 A T 9: 25,252,684 N16Y possibly damaging Het
Sparcl1 T C 5: 104,093,352 N69D probably benign Het
Ssh3 A T 19: 4,267,964 V41E probably damaging Het
Tmem253 A G 14: 52,018,846 R168G probably benign Het
Vmn2r60 T A 7: 42,142,230 F526I probably damaging Het
Vmn2r73 A T 7: 85,872,941 probably benign Het
Vps4b A G 1: 106,782,684 F156L possibly damaging Het
Zfp354c T A 11: 50,815,192 H352L probably damaging Het
Zic2 A T 14: 122,476,118 H148L possibly damaging Het
Other mutations in Atf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Atf6 APN 1 170788606 critical splice donor site probably null
IGL01431:Atf6 APN 1 170853002 splice site probably benign
IGL01755:Atf6 APN 1 170788611 missense possibly damaging 0.63
IGL02060:Atf6 APN 1 170819420 missense probably damaging 0.99
IGL02416:Atf6 APN 1 170747157 nonsense probably null
IGL02903:Atf6 APN 1 170799714 missense probably benign 0.00
IGL02989:Atf6 APN 1 170788683 splice site probably benign
IGL03209:Atf6 APN 1 170834894 missense probably benign
R0455:Atf6 UTSW 1 170834923 missense probably benign 0.00
R0467:Atf6 UTSW 1 170794020 missense probably damaging 1.00
R0491:Atf6 UTSW 1 170787344 critical splice donor site probably null
R0784:Atf6 UTSW 1 170709947 missense probably benign 0.19
R1486:Atf6 UTSW 1 170794691 missense probably damaging 1.00
R1850:Atf6 UTSW 1 170819286 missense probably damaging 1.00
R1945:Atf6 UTSW 1 170855141 missense probably benign 0.00
R2164:Atf6 UTSW 1 170794735 missense probably damaging 1.00
R3782:Atf6 UTSW 1 170794767 nonsense probably null
R4454:Atf6 UTSW 1 170794039 missense probably damaging 0.99
R4631:Atf6 UTSW 1 170747197 splice site probably null
R4676:Atf6 UTSW 1 170787410 missense probably damaging 1.00
R5772:Atf6 UTSW 1 170747189 missense probably damaging 1.00
R5860:Atf6 UTSW 1 170841775 missense probably damaging 1.00
R5860:Atf6 UTSW 1 170841776 missense possibly damaging 0.95
R5950:Atf6 UTSW 1 170834879 missense probably damaging 1.00
R6242:Atf6 UTSW 1 170793976 missense possibly damaging 0.46
R6520:Atf6 UTSW 1 170867669 missense probably benign 0.00
R7032:Atf6 UTSW 1 170799612 critical splice donor site probably null
R7472:Atf6 UTSW 1 170815491 missense possibly damaging 0.83
R7923:Atf6 UTSW 1 170794706 missense probably benign
R8002:Atf6 UTSW 1 170819254 missense probably benign 0.43
R8956:Atf6 UTSW 1 170794007 missense probably damaging 0.98
R9090:Atf6 UTSW 1 170794676 missense probably damaging 1.00
R9271:Atf6 UTSW 1 170794676 missense probably damaging 1.00
R9323:Atf6 UTSW 1 170855113 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGAGGCTCCGAATTGCAG -3'
(R):5'- CTTGTCCTTTGGTGAGCCAGAAG -3'

Sequencing Primer
(F):5'- TCCGAATTGCAGGTAACCCTAG -3'
(R):5'- TGAGCCAGAAGTGCTGTATCC -3'
Posted On 2021-07-15