Incidental Mutation 'R8860:Intu'
ID675595
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Nameinturned planar cell polarity protein
SynonymsPdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8860 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location40531286-40704774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40672732 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 314 (M314I)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091186]
AlphaFold Q059U7
Predicted Effect probably benign
Transcript: ENSMUST00000091186
AA Change: M314I

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: M314I

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T G 12: 71,184,423 V985G possibly damaging Het
Acr T G 15: 89,573,854 M246R probably damaging Het
Ago4 A T 4: 126,493,250 D853E probably benign Het
Atf6 A T 1: 170,852,966 F52L probably null Het
Blm A T 7: 80,494,528 C782S probably benign Het
C2cd5 A G 6: 143,083,220 Y98H probably benign Het
Ccdc106 A G 7: 5,059,571 D192G probably benign Het
Celf2 A G 2: 6,560,657 probably null Het
Chd1l A G 3: 97,570,369 F690S probably benign Het
Chuk A G 19: 44,087,968 S435P possibly damaging Het
Cisd3 T A 11: 97,685,877 S10T probably benign Het
Cma2 G T 14: 55,973,117 C143F probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Cnppd1 A G 1: 75,136,419 S402P probably damaging Het
Crtc1 A G 8: 70,388,155 S474P probably damaging Het
Dhx38 A T 8: 109,562,729 L13* probably null Het
Fat4 A T 3: 38,892,120 T1721S probably benign Het
Fntb T A 12: 76,888,052 V201E possibly damaging Het
Gga3 T C 11: 115,590,418 D242G probably benign Het
Hif3a A T 7: 17,040,987 M562K probably benign Het
Hnrnpc A G 14: 52,075,335 S261P possibly damaging Het
Lims1 C T 10: 58,408,103 Q126* probably null Het
Lrrc14b T A 13: 74,361,289 D333V probably damaging Het
Meaf6 T A 4: 125,086,197 L48Q probably damaging Het
Miip T A 4: 147,866,382 probably benign Het
Myh4 T A 11: 67,241,509 I155N probably damaging Het
Nnt T C 13: 119,339,871 Y733C Het
Nup155 T C 15: 8,130,156 V517A possibly damaging Het
Obscn C T 11: 59,007,614 R6607Q unknown Het
Olfr320 C T 11: 58,684,140 T89I probably benign Het
Olfr571 A G 7: 102,909,129 S237P probably benign Het
Ptprg T C 14: 12,213,685 Y1018H probably damaging Het
Rdh8 A C 9: 20,822,725 N69T probably benign Het
Rgsl1 G A 1: 153,821,354 Q572* probably null Het
Sept7 A T 9: 25,252,684 N16Y possibly damaging Het
Sparcl1 T C 5: 104,093,352 N69D probably benign Het
Ssh3 A T 19: 4,267,964 V41E probably damaging Het
Tbc1d5 TTGCTGCTGCTGCTGCTGCTGGTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGGTGCTGCTGCTGCTG 17: 50,799,955 probably benign Het
Tmem253 A G 14: 52,018,846 R168G probably benign Het
Vmn2r60 T A 7: 42,142,230 F526I probably damaging Het
Vps4b A G 1: 106,782,684 F156L possibly damaging Het
Zfp354c T A 11: 50,815,192 H352L probably damaging Het
Zic2 A T 14: 122,476,118 H148L possibly damaging Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40664266 missense probably benign 0.12
IGL01386:Intu APN 3 40692587 missense probably damaging 1.00
IGL02645:Intu APN 3 40701272 missense probably benign 0.01
IGL02869:Intu APN 3 40687786 missense probably damaging 1.00
IGL03263:Intu APN 3 40672597 nonsense probably null
H8562:Intu UTSW 3 40692673 missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40697603 missense probably benign 0.07
R0010:Intu UTSW 3 40654272 intron probably benign
R0173:Intu UTSW 3 40675346 critical splice donor site probably null
R0426:Intu UTSW 3 40675305 missense probably damaging 0.97
R1566:Intu UTSW 3 40692578 missense probably damaging 0.99
R1619:Intu UTSW 3 40697631 nonsense probably null
R1658:Intu UTSW 3 40692781 missense probably benign 0.20
R1701:Intu UTSW 3 40664264 missense probably damaging 1.00
R1707:Intu UTSW 3 40540924 missense probably benign 0.03
R1707:Intu UTSW 3 40683501 missense possibly damaging 0.69
R1867:Intu UTSW 3 40664335 missense probably damaging 1.00
R1868:Intu UTSW 3 40664335 missense probably damaging 1.00
R2090:Intu UTSW 3 40683536 missense probably benign 0.00
R2310:Intu UTSW 3 40653813 missense probably benign
R2989:Intu UTSW 3 40692710 missense probably benign 0.11
R4168:Intu UTSW 3 40672623 missense probably benign 0.00
R4530:Intu UTSW 3 40683364 missense possibly damaging 0.95
R5093:Intu UTSW 3 40692917 missense probably benign 0.00
R5541:Intu UTSW 3 40692587 splice site probably null
R5587:Intu UTSW 3 40675308 missense probably damaging 0.99
R5745:Intu UTSW 3 40692972 splice site probably null
R5809:Intu UTSW 3 40679590 missense probably damaging 0.99
R5939:Intu UTSW 3 40692584 missense probably damaging 1.00
R5953:Intu UTSW 3 40679550 missense probably damaging 1.00
R6000:Intu UTSW 3 40654148 nonsense probably null
R6063:Intu UTSW 3 40654094 missense probably damaging 0.97
R6245:Intu UTSW 3 40675326 missense probably damaging 0.98
R6310:Intu UTSW 3 40701291 nonsense probably null
R6353:Intu UTSW 3 40653708 missense probably damaging 1.00
R6451:Intu UTSW 3 40701293 missense possibly damaging 0.94
R6660:Intu UTSW 3 40531951 missense probably benign 0.00
R6848:Intu UTSW 3 40694255 missense probably benign 0.00
R7440:Intu UTSW 3 40697551 missense probably benign 0.04
R7625:Intu UTSW 3 40697599 missense probably benign
R7633:Intu UTSW 3 40654253 missense probably damaging 1.00
R7798:Intu UTSW 3 40691929 missense probably damaging 1.00
R7877:Intu UTSW 3 40699792 missense probably benign 0.07
R7978:Intu UTSW 3 40697639 missense probably damaging 1.00
R8319:Intu UTSW 3 40653772 missense probably damaging 1.00
R8332:Intu UTSW 3 40675289 missense probably benign 0.35
R8926:Intu UTSW 3 40653709 missense possibly damaging 0.69
R8946:Intu UTSW 3 40683359 missense possibly damaging 0.93
Z1177:Intu UTSW 3 40697516 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACCCAACAAGGTTTCTGTTTTC -3'
(R):5'- TGCAGACAGTGACAAGGCAC -3'

Sequencing Primer
(F):5'- CTTCTTTTCAGGTGAAGCTGAC -3'
(R):5'- CAGTGACAAGGCACAGGTAAC -3'
Posted On2021-07-15