Mutagenetix > Incidental Mutation

Incidental Mutation 'R0731:Mast3'

67560

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

038912-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0731 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70781321 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 178 (S178P)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000034296

SMART Domains

Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
SH3	7	79	4e-7	SMART
RhoGAP	122	286	2.36e-18	SMART
low complexity region	291	311	N/A	INTRINSIC
SH2	322	405	4.51e-26	SMART
Pfam:PI3K_P85_iSH2	422	590	1.7e-64	PFAM
SH2	614	696	9.96e-28	SMART
low complexity region	713	718	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142370

Predicted Effect

probably benign
Transcript: ENSMUST00000166004
AA Change: S943P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: S943P

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191396

Predicted Effect

probably benign
Transcript: ENSMUST00000211948
AA Change: S927P

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212140
AA Change: S178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Meta Mutation Damage Score

0.1250

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

97% (73/75)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430F08Rik	T	C	10: 100,586,203	T66A	probably damaging	Het
4933406M09Rik	A	C	1: 134,389,975	M162L	probably benign	Het
Acsm3	A	T	7: 119,768,024	R27*	probably null	Het
Actg1	A	G	11: 120,346,949	F255S	probably damaging	Het
Ahdc1	T	A	4: 133,062,951	V501E	possibly damaging	Het
Alpk2	A	T	18: 65,305,390	D1444E	probably damaging	Het
Btaf1	T	G	19: 36,997,495		probably null	Het
Cacnb2	A	G	2: 14,985,706	H489R	possibly damaging	Het
Ccdc162	C	A	10: 41,579,143	K398N	probably damaging	Het
Cd79b	G	T	11: 106,312,433	S145R	probably damaging	Het
Cdh11	T	A	8: 102,668,019	N264Y	probably damaging	Het
Celsr1	T	C	15: 85,901,597	D2892G	probably benign	Het
Chuk	A	G	19: 44,103,766		probably benign	Het
Clk3	T	C	9: 57,751,126		probably benign	Het
Dcaf8	A	T	1: 172,172,509	D78V	possibly damaging	Het
Dctn1	A	G	6: 83,183,089	T87A	probably damaging	Het
Ddx50	T	C	10: 62,616,249	N732D	unknown	Het
Dnah5	A	T	15: 28,311,143	Y1756F	possibly damaging	Het
Dock3	A	T	9: 106,969,856	V858E	probably damaging	Het
Fer1l4	A	G	2: 156,024,070	F1566S	probably benign	Het
Fpr-rs7	T	C	17: 20,113,854	I125V	probably benign	Het
Fuca2	C	T	10: 13,506,027	P228L	probably benign	Het
Galntl6	A	G	8: 58,535,984	F57L	probably benign	Het
Gigyf2	T	A	1: 87,407,727		probably benign	Het
Gm16505	A	T	13: 3,361,329		noncoding transcript	Het
Gm4781	T	C	10: 100,396,777		noncoding transcript	Het
Gm9956	T	A	10: 56,745,543	Y100*	probably null	Het
Gpr137c	T	A	14: 45,246,349	C178S	probably damaging	Het
Gpr83	A	G	9: 14,868,644	R331G	probably benign	Het
Hlcs	T	A	16: 94,131,852	H851L	probably damaging	Het
Kbtbd6	C	A	14: 79,451,884	Y6*	probably null	Het
Kif23	T	C	9: 61,925,032	R610G	possibly damaging	Het
Kifc3	G	A	8: 95,105,733	T487I	probably damaging	Het
Klra5	A	C	6: 129,908,796	D133E	possibly damaging	Het
Klra6	T	C	6: 130,022,705	E100G	probably damaging	Het
Klre1	T	A	6: 129,585,568		probably benign	Het
Lancl1	C	T	1: 67,009,910		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Man1b1	A	G	2: 25,338,155	I146V	possibly damaging	Het
Map4k5	T	A	12: 69,874,264		probably benign	Het
Mau2	A	G	8: 70,023,612		probably null	Het
Mkrn2	A	T	6: 115,614,651	N312Y	probably damaging	Het
Mrvi1	T	C	7: 110,876,900	S615G	probably benign	Het
Myh1	A	G	11: 67,202,533	E150G	probably damaging	Het
Myo7b	T	A	18: 31,961,825		probably null	Het
Nyap1	A	G	5: 137,735,298	V491A	probably damaging	Het
Olfr1284	A	G	2: 111,379,293	M98V	probably damaging	Het
Olfr484	T	C	7: 108,124,734	I176M	probably benign	Het
Olfr518	A	T	7: 108,881,533	N24K	probably damaging	Het
Olfr954	T	C	9: 39,461,532	F34L	probably damaging	Het
Oxsm	A	T	14: 16,240,893	H385Q	probably damaging	Het
Pbld2	T	C	10: 63,056,811	S242P	probably damaging	Het
Pdzd7	T	C	19: 45,029,305	Y675C	probably damaging	Het
Pnkd	T	A	1: 74,351,541	H266Q	probably damaging	Het
Rbfox2	A	G	15: 77,099,279	S141P	probably benign	Het
Rdx	A	G	9: 52,068,218	T214A	probably benign	Het
Ripor2	A	T	13: 24,680,644	E219V	probably damaging	Het
Rufy2	G	A	10: 63,011,844		probably benign	Het
Slf2	T	A	19: 44,975,726		probably benign	Het
Snrnp200	G	T	2: 127,226,145		probably benign	Het
Snx7	T	A	3: 117,829,671		probably benign	Het
Stt3a	T	C	9: 36,735,512	I602V	probably damaging	Het
Tacr3	G	A	3: 134,855,000		probably null	Het
Tcerg1	C	T	18: 42,571,840	T978M	probably damaging	Het
Tcf7l1	G	T	6: 72,788,269	P126Q	possibly damaging	Het
Trank1	A	G	9: 111,365,488	D860G	probably damaging	Het
Try4	T	C	6: 41,304,367	L81P	probably benign	Het
Ucp1	T	C	8: 83,297,847		probably benign	Het
Ugt2b38	G	A	5: 87,420,452	A328V	probably damaging	Het
Wfikkn1	T	A	17: 25,878,017	R444S	probably damaging	Het
Zfc3h1	A	G	10: 115,410,632	T875A	probably benign	Het
Zfp11	A	G	5: 129,657,264	S378P	probably damaging	Het
Zfp984	T	A	4: 147,756,232	N54I	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CGTCACTATCACCCATGTAGACACG -3'
(R):5'- TGTCAAGCTCACCCAAGTTGTCCC -3'

Sequencing Primer
(F):5'- CCCATGTAGACACGAATGGC -3'
(R):5'- TCATCATCACGGCAGGTGATATG -3'

Posted On

2013-09-03