Incidental Mutation 'R0731:Ucp1'
ID 67561
Institutional Source Beutler Lab
Gene Symbol Ucp1
Ensembl Gene ENSMUSG00000031710
Gene Name uncoupling protein 1 (mitochondrial, proton carrier)
Synonyms Slc25a7
MMRRC Submission 038912-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0731 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 84016981-84025081 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 84024476 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034146]
AlphaFold P12242
Predicted Effect probably benign
Transcript: ENSMUST00000034146
SMART Domains Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710

DomainStartEndE-ValueType
Pfam:Mito_carr 10 107 5.7e-20 PFAM
Pfam:Mito_carr 109 206 3.3e-20 PFAM
Pfam:Mito_carr 209 300 1.6e-18 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,367,247 (GRCm39) R27* probably null Het
Actg1 A G 11: 120,237,775 (GRCm39) F255S probably damaging Het
Ahdc1 T A 4: 132,790,262 (GRCm39) V501E possibly damaging Het
Alpk2 A T 18: 65,438,461 (GRCm39) D1444E probably damaging Het
Btaf1 T G 19: 36,974,895 (GRCm39) probably null Het
Cacnb2 A G 2: 14,990,517 (GRCm39) H489R possibly damaging Het
Ccdc162 C A 10: 41,455,139 (GRCm39) K398N probably damaging Het
Cd79b G T 11: 106,203,259 (GRCm39) S145R probably damaging Het
Cdh11 T A 8: 103,394,651 (GRCm39) N264Y probably damaging Het
Celsr1 T C 15: 85,785,798 (GRCm39) D2892G probably benign Het
Chuk A G 19: 44,092,205 (GRCm39) probably benign Het
Clk3 T C 9: 57,658,409 (GRCm39) probably benign Het
Dcaf8 A T 1: 172,000,076 (GRCm39) D78V possibly damaging Het
Dctn1 A G 6: 83,160,071 (GRCm39) T87A probably damaging Het
Ddx50 T C 10: 62,452,028 (GRCm39) N732D unknown Het
Dnah5 A T 15: 28,311,289 (GRCm39) Y1756F possibly damaging Het
Dock3 A T 9: 106,847,055 (GRCm39) V858E probably damaging Het
Fer1l4 A G 2: 155,865,990 (GRCm39) F1566S probably benign Het
Fpr-rs7 T C 17: 20,334,116 (GRCm39) I125V probably benign Het
Fuca2 C T 10: 13,381,771 (GRCm39) P228L probably benign Het
Galntl6 A G 8: 58,989,018 (GRCm39) F57L probably benign Het
Gigyf2 T A 1: 87,335,449 (GRCm39) probably benign Het
Gm16505 A T 13: 3,411,329 (GRCm39) noncoding transcript Het
Gm4781 T C 10: 100,232,639 (GRCm39) noncoding transcript Het
Gm9956 T A 10: 56,621,639 (GRCm39) Y100* probably null Het
Gpr137c T A 14: 45,483,806 (GRCm39) C178S probably damaging Het
Gpr83 A G 9: 14,779,940 (GRCm39) R331G probably benign Het
Hlcs T A 16: 93,932,711 (GRCm39) H851L probably damaging Het
Irag1 T C 7: 110,476,107 (GRCm39) S615G probably benign Het
Kbtbd6 C A 14: 79,689,324 (GRCm39) Y6* probably null Het
Kif23 T C 9: 61,832,314 (GRCm39) R610G possibly damaging Het
Kifc3 G A 8: 95,832,361 (GRCm39) T487I probably damaging Het
Klra5 A C 6: 129,885,759 (GRCm39) D133E possibly damaging Het
Klra6 T C 6: 129,999,668 (GRCm39) E100G probably damaging Het
Klre1 T A 6: 129,562,531 (GRCm39) probably benign Het
Lancl1 C T 1: 67,049,069 (GRCm39) probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Man1b1 A G 2: 25,228,167 (GRCm39) I146V possibly damaging Het
Map4k5 T A 12: 69,921,038 (GRCm39) probably benign Het
Mast3 A G 8: 71,233,965 (GRCm39) S178P probably damaging Het
Mau2 A G 8: 70,476,262 (GRCm39) probably null Het
Mgat4f A C 1: 134,317,713 (GRCm39) M162L probably benign Het
Mkrn2 A T 6: 115,591,612 (GRCm39) N312Y probably damaging Het
Myh1 A G 11: 67,093,359 (GRCm39) E150G probably damaging Het
Myo7b T A 18: 32,094,878 (GRCm39) probably null Het
Nyap1 A G 5: 137,733,560 (GRCm39) V491A probably damaging Het
Or10a3 A T 7: 108,480,740 (GRCm39) N24K probably damaging Het
Or4g17 A G 2: 111,209,638 (GRCm39) M98V probably damaging Het
Or5p60 T C 7: 107,723,941 (GRCm39) I176M probably benign Het
Or8g34 T C 9: 39,372,828 (GRCm39) F34L probably damaging Het
Oxsm A T 14: 16,240,893 (GRCm38) H385Q probably damaging Het
Pbld2 T C 10: 62,892,590 (GRCm39) S242P probably damaging Het
Pdzd7 T C 19: 45,017,744 (GRCm39) Y675C probably damaging Het
Pnkd T A 1: 74,390,700 (GRCm39) H266Q probably damaging Het
Rbfox2 A G 15: 76,983,479 (GRCm39) S141P probably benign Het
Rdx A G 9: 51,979,518 (GRCm39) T214A probably benign Het
Ripor2 A T 13: 24,864,627 (GRCm39) E219V probably damaging Het
Rlig1 T C 10: 100,422,065 (GRCm39) T66A probably damaging Het
Rufy2 G A 10: 62,847,623 (GRCm39) probably benign Het
Slf2 T A 19: 44,964,165 (GRCm39) probably benign Het
Snrnp200 G T 2: 127,068,065 (GRCm39) probably benign Het
Snx7 T A 3: 117,623,320 (GRCm39) probably benign Het
Stt3a T C 9: 36,646,808 (GRCm39) I602V probably damaging Het
Tacr3 G A 3: 134,560,761 (GRCm39) probably null Het
Tcerg1 C T 18: 42,704,905 (GRCm39) T978M probably damaging Het
Tcf7l1 G T 6: 72,765,252 (GRCm39) P126Q possibly damaging Het
Trank1 A G 9: 111,194,556 (GRCm39) D860G probably damaging Het
Try4 T C 6: 41,281,301 (GRCm39) L81P probably benign Het
Ugt2b38 G A 5: 87,568,311 (GRCm39) A328V probably damaging Het
Wfikkn1 T A 17: 26,096,991 (GRCm39) R444S probably damaging Het
Zfc3h1 A G 10: 115,246,537 (GRCm39) T875A probably benign Het
Zfp11 A G 5: 129,734,328 (GRCm39) S378P probably damaging Het
Zfp984 T A 4: 147,840,689 (GRCm39) N54I probably damaging Het
Other mutations in Ucp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4585001:Ucp1 UTSW 8 84,020,577 (GRCm39) missense probably damaging 1.00
R0050:Ucp1 UTSW 8 84,020,857 (GRCm39) missense probably damaging 1.00
R0055:Ucp1 UTSW 8 84,017,233 (GRCm39) nonsense probably null
R0055:Ucp1 UTSW 8 84,017,233 (GRCm39) nonsense probably null
R0505:Ucp1 UTSW 8 84,021,936 (GRCm39) missense possibly damaging 0.78
R0590:Ucp1 UTSW 8 84,018,232 (GRCm39) splice site probably benign
R0681:Ucp1 UTSW 8 84,021,936 (GRCm39) missense possibly damaging 0.78
R1606:Ucp1 UTSW 8 84,021,933 (GRCm39) missense probably damaging 1.00
R1722:Ucp1 UTSW 8 84,017,317 (GRCm39) missense probably benign 0.25
R1809:Ucp1 UTSW 8 84,024,496 (GRCm39) missense probably damaging 0.99
R1823:Ucp1 UTSW 8 84,020,661 (GRCm39) missense probably damaging 1.00
R3809:Ucp1 UTSW 8 84,017,270 (GRCm39) missense probably damaging 0.99
R4085:Ucp1 UTSW 8 84,020,580 (GRCm39) missense probably benign 0.43
R4673:Ucp1 UTSW 8 84,021,876 (GRCm39) missense probably damaging 1.00
R4998:Ucp1 UTSW 8 84,024,484 (GRCm39) critical splice acceptor site probably null
R5163:Ucp1 UTSW 8 84,020,832 (GRCm39) missense possibly damaging 0.95
R5421:Ucp1 UTSW 8 84,017,320 (GRCm39) missense probably benign 0.12
R5790:Ucp1 UTSW 8 84,024,520 (GRCm39) missense possibly damaging 0.54
R5994:Ucp1 UTSW 8 84,020,567 (GRCm39) missense possibly damaging 0.92
R6574:Ucp1 UTSW 8 84,020,718 (GRCm39) critical splice donor site probably null
R6732:Ucp1 UTSW 8 84,018,106 (GRCm39) missense probably benign 0.08
R7282:Ucp1 UTSW 8 84,020,531 (GRCm39) missense probably benign 0.03
R7343:Ucp1 UTSW 8 84,021,881 (GRCm39) missense probably damaging 0.99
R7878:Ucp1 UTSW 8 84,024,521 (GRCm39) missense probably benign 0.19
R8008:Ucp1 UTSW 8 84,020,640 (GRCm39) missense probably benign 0.32
R8365:Ucp1 UTSW 8 84,020,628 (GRCm39) missense probably damaging 0.97
R8899:Ucp1 UTSW 8 84,017,216 (GRCm39) missense probably benign 0.35
R9186:Ucp1 UTSW 8 84,017,272 (GRCm39) nonsense probably null
R9499:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
R9551:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
R9552:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAAGGAGGGAAGTGTTGCTTG -3'
(R):5'- CTCCCAGCATAGAAGCCCAATGATG -3'

Sequencing Primer
(F):5'- AAGTGTTGCTTGGCAACTCC -3'
(R):5'- GAAGCCCAATGATGTTCAGTATCTC -3'
Posted On 2013-09-03