Incidental Mutation 'R8861:Olfr1036'
ID675638
Institutional Source Beutler Lab
Gene Symbol Olfr1036
Ensembl Gene ENSMUSG00000099820
Gene Nameolfactory receptor 1036
SynonymsGA_x6K02T2Q125-47549689-47550621, MOR245-25, MOR262-13
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock #R8861 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86073992-86077194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86075616 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 292 (N292S)
Ref Sequence ENSEMBL: ENSMUSP00000130843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164985]
Predicted Effect probably damaging
Transcript: ENSMUST00000164985
AA Change: N292S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130843
Gene: ENSMUSG00000099820
AA Change: N292S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.2e-51 PFAM
Pfam:7tm_1 39 288 1.1e-21 PFAM
Meta Mutation Damage Score 0.3515 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,259,961 K1168* probably null Het
Acly A G 11: 100,484,598 probably null Het
Agap2 T G 10: 127,090,514 V896G unknown Het
Agtpbp1 T C 13: 59,495,473 Y724C probably damaging Het
Angpt4 A G 2: 151,925,453 N135D probably damaging Het
Aox3 T A 1: 58,150,301 I387K probably benign Het
Bysl T C 17: 47,606,959 E103G probably benign Het
Chmp5 T A 4: 40,964,608 V208E probably damaging Het
Chst9 T G 18: 15,452,573 H311P possibly damaging Het
Dcaf11 C A 14: 55,564,498 Y235* probably null Het
Dlx5 A C 6: 6,878,233 S266A probably benign Het
Dnah7b T A 1: 46,241,076 S2722T possibly damaging Het
En2 T A 5: 28,166,735 I70N probably damaging Het
Fam72a T C 1: 131,538,918 Y147H possibly damaging Het
Fermt2 A T 14: 45,460,009 F628L possibly damaging Het
Fkrp T A 7: 16,810,824 D371V probably damaging Het
Fmn1 T C 2: 113,364,804 L283P unknown Het
Gm13271 G A 4: 88,755,129 V88I probably benign Het
Gnmt G A 17: 46,726,692 T120M probably damaging Het
H2-T22 A T 17: 36,042,398 V10D possibly damaging Het
Ick T A 9: 78,164,562 N505K probably benign Het
Igf2bp3 A C 6: 49,105,616 M344R possibly damaging Het
Kdm1b T C 13: 47,064,106 V347A probably benign Het
Klra17 A T 6: 129,874,902 S2R probably damaging Het
Klri1 A G 6: 129,698,201 S199P probably benign Het
Ltk T A 2: 119,759,613 Q44L probably benign Het
Matn4 A T 2: 164,392,905 Y549N Het
Mcoln3 T A 3: 146,139,404 F452I probably damaging Het
Mipol1 T C 12: 57,306,016 V47A probably benign Het
Msh4 A G 3: 153,901,468 L145S probably benign Het
Myh11 A T 16: 14,246,782 I224N Het
Nat8f1 A G 6: 85,910,462 L172P probably damaging Het
Ncoa7 T A 10: 30,691,368 K438I probably benign Het
Nr1h3 T G 2: 91,193,681 probably benign Het
Nuggc T C 14: 65,610,035 probably null Het
Olfr1271 T C 2: 90,266,459 probably benign Het
Olfr871 A T 9: 20,213,081 H244L probably damaging Het
Pfn4 T A 12: 4,775,456 Y98N probably benign Het
Ppp6r2 T G 15: 89,259,165 C172G probably damaging Het
Ptprk A G 10: 28,570,190 D979G probably damaging Het
Rbm28 A G 6: 29,152,285 I329T probably damaging Het
Rnf144a T C 12: 26,339,344 T33A probably damaging Het
Rnf145 A G 11: 44,555,157 T273A probably damaging Het
Rnf213 G A 11: 119,442,236 R2758H Het
Slc22a19 A T 19: 7,682,959 M362K possibly damaging Het
Slc29a4 G C 5: 142,718,825 R374P probably damaging Het
Slc43a1 A G 2: 84,861,404 T528A possibly damaging Het
Sp3 A T 2: 72,971,286 Y172N probably damaging Het
Srpr T A 9: 35,215,749 M573K probably benign Het
Steap4 A G 5: 7,975,672 I78V probably benign Het
Sulf2 A G 2: 166,132,686 L26P possibly damaging Het
Taok2 T C 7: 126,871,443 K738E probably damaging Het
Tcea3 G A 4: 136,254,499 R56H probably damaging Het
Tcf20 A G 15: 82,852,525 V1575A probably damaging Het
Togaram1 T G 12: 64,980,632 S798R possibly damaging Het
Other mutations in Olfr1036
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Olfr1036 APN 2 86075472 missense possibly damaging 0.90
IGL02370:Olfr1036 APN 2 86074788 missense probably damaging 0.98
R0269:Olfr1036 UTSW 2 86075141 missense probably benign 0.03
R0409:Olfr1036 UTSW 2 86075302 nonsense probably null
R0412:Olfr1036 UTSW 2 86075091 missense probably benign 0.16
R0617:Olfr1036 UTSW 2 86075141 missense probably benign 0.03
R0846:Olfr1036 UTSW 2 86075166 missense possibly damaging 0.66
R1251:Olfr1036 UTSW 2 86074820 missense probably benign 0.20
R1646:Olfr1036 UTSW 2 86075616 missense probably damaging 0.98
R1670:Olfr1036 UTSW 2 86075250 missense probably benign
R1775:Olfr1036 UTSW 2 86074760 missense possibly damaging 0.88
R1968:Olfr1036 UTSW 2 86075205 missense probably damaging 1.00
R2877:Olfr1036 UTSW 2 86075331 missense possibly damaging 0.82
R4639:Olfr1036 UTSW 2 86075579 missense probably benign 0.24
R4957:Olfr1036 UTSW 2 86075510 missense probably damaging 1.00
R5267:Olfr1036 UTSW 2 86075538 missense probably benign 0.28
R5862:Olfr1036 UTSW 2 86075646 missense probably benign 0.00
R6235:Olfr1036 UTSW 2 86075166 missense possibly damaging 0.66
R6355:Olfr1036 UTSW 2 86074872 missense probably benign 0.04
R6943:Olfr1036 UTSW 2 86074920 missense probably damaging 1.00
R8033:Olfr1036 UTSW 2 86074875 missense possibly damaging 0.61
R8796:Olfr1036 UTSW 2 86075174 missense possibly damaging 0.94
Z1088:Olfr1036 UTSW 2 86075323 missense possibly damaging 0.66
Z1177:Olfr1036 UTSW 2 86075424 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGCTGTGTTACGCATGCACTC -3'
(R):5'- AGCATCACTGTGGATAACTGGATC -3'

Sequencing Primer
(F):5'- TTACGCATGCACTCGGCTG -3'
(R):5'- CACTGTGGATAACTGGATCTTATGAG -3'
Posted On2021-07-15