Mutagenetix > Incidental Mutation

Incidental Mutation 'R0731:Stt3a'

67564

Institutional Source

Beutler Lab

Gene Symbol

Stt3a

Ensembl Gene

ENSMUSG00000032116

Gene Name

STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)

Synonyms

Itm1

MMRRC Submission

038912-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R0731 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36729344-36767679 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36735512 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 602 (I602V)

Ref Sequence

ENSEMBL: ENSMUSP00000113116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120381]

AlphaFold

P46978

Predicted Effect

probably damaging
Transcript: ENSMUST00000120381
AA Change: I602V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113116
Gene: ENSMUSG00000032116
AA Change: I602V

Domain	Start	End	E-Value	Type
Pfam:STT3	17	484	2e-163	PFAM
Pfam:PMT_2	97	257	9.3e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000135934

SMART Domains

Protein: ENSMUSP00000117794
Gene: ENSMUSG00000032116

Domain	Start	End	E-Value	Type
Pfam:STT3	1	112	1.8e-45	PFAM

Meta Mutation Damage Score

0.6121

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a catalytic subunit of the N-oligosaccharyltransferase (OST) complex, which functions in the endoplasmic reticulum to transfer glycan chains to asparagine residues of target proteins. A separate complex containing a similar catalytic subunit with an overlapping function also exists. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430F08Rik	T	C	10: 100,586,203	T66A	probably damaging	Het
4933406M09Rik	A	C	1: 134,389,975	M162L	probably benign	Het
Acsm3	A	T	7: 119,768,024	R27*	probably null	Het
Actg1	A	G	11: 120,346,949	F255S	probably damaging	Het
Ahdc1	T	A	4: 133,062,951	V501E	possibly damaging	Het
Alpk2	A	T	18: 65,305,390	D1444E	probably damaging	Het
Btaf1	T	G	19: 36,997,495		probably null	Het
Cacnb2	A	G	2: 14,985,706	H489R	possibly damaging	Het
Ccdc162	C	A	10: 41,579,143	K398N	probably damaging	Het
Cd79b	G	T	11: 106,312,433	S145R	probably damaging	Het
Cdh11	T	A	8: 102,668,019	N264Y	probably damaging	Het
Celsr1	T	C	15: 85,901,597	D2892G	probably benign	Het
Chuk	A	G	19: 44,103,766		probably benign	Het
Clk3	T	C	9: 57,751,126		probably benign	Het
Dcaf8	A	T	1: 172,172,509	D78V	possibly damaging	Het
Dctn1	A	G	6: 83,183,089	T87A	probably damaging	Het
Ddx50	T	C	10: 62,616,249	N732D	unknown	Het
Dnah5	A	T	15: 28,311,143	Y1756F	possibly damaging	Het
Dock3	A	T	9: 106,969,856	V858E	probably damaging	Het
Fer1l4	A	G	2: 156,024,070	F1566S	probably benign	Het
Fpr-rs7	T	C	17: 20,113,854	I125V	probably benign	Het
Fuca2	C	T	10: 13,506,027	P228L	probably benign	Het
Galntl6	A	G	8: 58,535,984	F57L	probably benign	Het
Gigyf2	T	A	1: 87,407,727		probably benign	Het
Gm16505	A	T	13: 3,361,329		noncoding transcript	Het
Gm4781	T	C	10: 100,396,777		noncoding transcript	Het
Gm9956	T	A	10: 56,745,543	Y100*	probably null	Het
Gpr137c	T	A	14: 45,246,349	C178S	probably damaging	Het
Gpr83	A	G	9: 14,868,644	R331G	probably benign	Het
Hlcs	T	A	16: 94,131,852	H851L	probably damaging	Het
Kbtbd6	C	A	14: 79,451,884	Y6*	probably null	Het
Kif23	T	C	9: 61,925,032	R610G	possibly damaging	Het
Kifc3	G	A	8: 95,105,733	T487I	probably damaging	Het
Klra5	A	C	6: 129,908,796	D133E	possibly damaging	Het
Klra6	T	C	6: 130,022,705	E100G	probably damaging	Het
Klre1	T	A	6: 129,585,568		probably benign	Het
Lancl1	C	T	1: 67,009,910		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Man1b1	A	G	2: 25,338,155	I146V	possibly damaging	Het
Map4k5	T	A	12: 69,874,264		probably benign	Het
Mast3	A	G	8: 70,781,321	S178P	probably damaging	Het
Mau2	A	G	8: 70,023,612		probably null	Het
Mkrn2	A	T	6: 115,614,651	N312Y	probably damaging	Het
Mrvi1	T	C	7: 110,876,900	S615G	probably benign	Het
Myh1	A	G	11: 67,202,533	E150G	probably damaging	Het
Myo7b	T	A	18: 31,961,825		probably null	Het
Nyap1	A	G	5: 137,735,298	V491A	probably damaging	Het
Olfr1284	A	G	2: 111,379,293	M98V	probably damaging	Het
Olfr484	T	C	7: 108,124,734	I176M	probably benign	Het
Olfr518	A	T	7: 108,881,533	N24K	probably damaging	Het
Olfr954	T	C	9: 39,461,532	F34L	probably damaging	Het
Oxsm	A	T	14: 16,240,893	H385Q	probably damaging	Het
Pbld2	T	C	10: 63,056,811	S242P	probably damaging	Het
Pdzd7	T	C	19: 45,029,305	Y675C	probably damaging	Het
Pnkd	T	A	1: 74,351,541	H266Q	probably damaging	Het
Rbfox2	A	G	15: 77,099,279	S141P	probably benign	Het
Rdx	A	G	9: 52,068,218	T214A	probably benign	Het
Ripor2	A	T	13: 24,680,644	E219V	probably damaging	Het
Rufy2	G	A	10: 63,011,844		probably benign	Het
Slf2	T	A	19: 44,975,726		probably benign	Het
Snrnp200	G	T	2: 127,226,145		probably benign	Het
Snx7	T	A	3: 117,829,671		probably benign	Het
Tacr3	G	A	3: 134,855,000		probably null	Het
Tcerg1	C	T	18: 42,571,840	T978M	probably damaging	Het
Tcf7l1	G	T	6: 72,788,269	P126Q	possibly damaging	Het
Trank1	A	G	9: 111,365,488	D860G	probably damaging	Het
Try4	T	C	6: 41,304,367	L81P	probably benign	Het
Ucp1	T	C	8: 83,297,847		probably benign	Het
Ugt2b38	G	A	5: 87,420,452	A328V	probably damaging	Het
Wfikkn1	T	A	17: 25,878,017	R444S	probably damaging	Het
Zfc3h1	A	G	10: 115,410,632	T875A	probably benign	Het
Zfp11	A	G	5: 129,657,264	S378P	probably damaging	Het
Zfp984	T	A	4: 147,756,232	N54I	probably damaging	Het

Other mutations in Stt3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01866:Stt3a	APN	9	36734366	missense	probably benign	0.00
IGL02237:Stt3a	APN	9	36749637	nonsense	probably null
IGL02644:Stt3a	APN	9	36752353	missense	possibly damaging	0.70
IGL02710:Stt3a	APN	9	36758745	missense	probably damaging	0.99
IGL03085:Stt3a	APN	9	36732970	intron	probably benign
IGL03180:Stt3a	APN	9	36759256	missense	probably damaging	1.00
IGL03295:Stt3a	APN	9	36763331	splice site	probably null
Scramble	UTSW	9	36735466	missense	probably damaging	1.00
Western	UTSW	9	36735386	missense	probably damaging	1.00
R0314:Stt3a	UTSW	9	36749545	intron	probably benign
R1188:Stt3a	UTSW	9	36751340	missense	probably damaging	1.00
R1797:Stt3a	UTSW	9	36743415	critical splice donor site	probably null
R1846:Stt3a	UTSW	9	36763385	missense	probably damaging	1.00
R2152:Stt3a	UTSW	9	36747996	missense	probably damaging	1.00
R2220:Stt3a	UTSW	9	36749551	critical splice donor site	probably null
R2317:Stt3a	UTSW	9	36748075	missense	probably benign	0.08
R3689:Stt3a	UTSW	9	36759322	missense	probably damaging	1.00
R4299:Stt3a	UTSW	9	36763344	missense	probably damaging	1.00
R4586:Stt3a	UTSW	9	36741793	missense	probably damaging	1.00
R4595:Stt3a	UTSW	9	36735512	missense	probably damaging	1.00
R4689:Stt3a	UTSW	9	36732929	missense	possibly damaging	0.91
R4736:Stt3a	UTSW	9	36749712	missense	probably benign	0.01
R5145:Stt3a	UTSW	9	36735466	missense	probably damaging	1.00
R5208:Stt3a	UTSW	9	36746595	missense	possibly damaging	0.78
R5665:Stt3a	UTSW	9	36759314	missense	probably damaging	1.00
R5748:Stt3a	UTSW	9	36752400	missense	probably benign	0.21
R6341:Stt3a	UTSW	9	36751296	missense	probably damaging	1.00
R6853:Stt3a	UTSW	9	36741727	missense	possibly damaging	0.89
R6859:Stt3a	UTSW	9	36735386	missense	probably damaging	1.00
R7453:Stt3a	UTSW	9	36747970	missense	possibly damaging	0.91
R7495:Stt3a	UTSW	9	36747939	missense	probably benign	0.03
R7745:Stt3a	UTSW	9	36751239	nonsense	probably null
R8007:Stt3a	UTSW	9	36741769	missense	probably damaging	1.00
R9176:Stt3a	UTSW	9	36751296	missense	probably damaging	1.00
R9218:Stt3a	UTSW	9	36759260	missense	probably damaging	0.98
R9552:Stt3a	UTSW	9	36734379	missense	probably benign	0.00
R9622:Stt3a	UTSW	9	36749729	missense	possibly damaging	0.95
R9784:Stt3a	UTSW	9	36758783	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TAGACCTGCCCAAAGCGGTAGTAAC -3'
(R):5'- CTTTCAGTGTGGCTTAAGACTGGACC -3'

Sequencing Primer
(F):5'- CACATTTTGTACATAAGGCAGTTGAG -3'
(R):5'- GCTTAAGACTGGACCAGTAATAGC -3'

Posted On

2013-09-03