Incidental Mutation 'R8861:Sulf2'
ID 675645
Institutional Source Beutler Lab
Gene Symbol Sulf2
Ensembl Gene ENSMUSG00000006800
Gene Name sulfatase 2
Synonyms 2010004N24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock # R8861 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 166073089-166155663 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 166132686 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 26 (L26P)
Ref Sequence ENSEMBL: ENSMUSP00000085405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088086] [ENSMUST00000109249] [ENSMUST00000133395] [ENSMUST00000139266] [ENSMUST00000146497]
AlphaFold Q8CFG0
Predicted Effect possibly damaging
Transcript: ENSMUST00000088086
AA Change: L26P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000085405
Gene: ENSMUSG00000006800
AA Change: L26P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 669 5.6e-47 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109249
AA Change: L26P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104872
Gene: ENSMUSG00000006800
AA Change: L26P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 532 670 1.3e-46 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133395
AA Change: L26P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000139266
AA Change: L26P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000146497
AA Change: L26P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate proteoglycans (HSPGs) act as coreceptors for numerous heparin-binding growth factors and cytokines and are involved in cell signaling. Heparan sulfate 6-O-endosulfatases, such as SULF2, selectively remove 6-O-sulfate groups from heparan sulfate. This activity modulates the effects of heparan sulfate by altering binding sites for signaling molecules (Dai et al., 2005 [PubMed 16192265]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous disruption of this gene may lead to a partially penetrant, strain-dependent phenotype of embryonic lethality, reduced postnatal body weight, lung abnormalities, brain malformations, and reduced fertility. Mice homozygous for a hypomorphic gene-trap allele display skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik T C 5: 139,410,887 probably benign Het
5430419D17Rik A T 7: 131,259,961 K1168* probably null Het
Acly A G 11: 100,484,598 probably null Het
Agap2 T G 10: 127,090,514 V896G unknown Het
Agtpbp1 T C 13: 59,495,473 Y724C probably damaging Het
Angpt4 A G 2: 151,925,453 N135D probably damaging Het
Aox3 T A 1: 58,150,301 I387K probably benign Het
Bysl T C 17: 47,606,959 E103G probably benign Het
Chmp5 T A 4: 40,964,608 V208E probably damaging Het
Chst9 T G 18: 15,452,573 H311P possibly damaging Het
Dcaf11 C A 14: 55,564,498 Y235* probably null Het
Dlx5 A C 6: 6,878,233 S266A probably benign Het
Dnah7b T A 1: 46,241,076 S2722T possibly damaging Het
Drc1 G A 5: 30,364,495 probably benign Het
En2 T A 5: 28,166,735 I70N probably damaging Het
Fam72a T C 1: 131,538,918 Y147H possibly damaging Het
Fermt2 A T 14: 45,460,009 F628L possibly damaging Het
Fkrp T A 7: 16,810,824 D371V probably damaging Het
Fmn1 T C 2: 113,364,804 L283P unknown Het
Gm13271 G A 4: 88,755,129 V88I probably benign Het
Gnmt G A 17: 46,726,692 T120M probably damaging Het
H2-T22 A T 17: 36,042,398 V10D possibly damaging Het
Hbs1l T A 10: 21,345,064 probably benign Het
Ick T A 9: 78,164,562 N505K probably benign Het
Igf2bp3 A C 6: 49,105,616 M344R possibly damaging Het
Kdm1b T C 13: 47,064,106 V347A probably benign Het
Klra17 A T 6: 129,874,902 S2R probably damaging Het
Klri1 A G 6: 129,698,201 S199P probably benign Het
Ltk T A 2: 119,759,613 Q44L probably benign Het
Map3k20 C A 2: 72,389,467 probably benign Het
Matn4 A T 2: 164,392,905 Y549N Het
Mcoln3 T A 3: 146,139,404 F452I probably damaging Het
Mipol1 T C 12: 57,306,016 V47A probably benign Het
Msh4 A G 3: 153,901,468 L145S probably benign Het
Myh11 A T 16: 14,246,782 I224N Het
Nat8f1 A G 6: 85,910,462 L172P probably damaging Het
Ncoa7 T A 10: 30,691,368 K438I probably benign Het
Nr1h3 T G 2: 91,193,681 probably benign Het
Nuggc T C 14: 65,610,035 probably null Het
Olfr1036 A G 2: 86,075,616 N292S probably damaging Het
Olfr1271 T C 2: 90,266,459 probably benign Het
Olfr871 A T 9: 20,213,081 H244L probably damaging Het
Pfn4 T A 12: 4,775,456 Y98N probably benign Het
Ppp6r2 T G 15: 89,259,165 C172G probably damaging Het
Ptprk A G 10: 28,570,190 D979G probably damaging Het
Rbm28 A G 6: 29,152,285 I329T probably damaging Het
Rnf144a T C 12: 26,339,344 T33A probably damaging Het
Rnf145 A G 11: 44,555,157 T273A probably damaging Het
Rnf213 G A 11: 119,442,236 R2758H Het
Slc22a19 A T 19: 7,682,959 M362K possibly damaging Het
Slc29a4 G C 5: 142,718,825 R374P probably damaging Het
Slc43a1 A G 2: 84,861,404 T528A possibly damaging Het
Sp3 A T 2: 72,971,286 Y172N probably damaging Het
Srpr T A 9: 35,215,749 M573K probably benign Het
Steap4 A G 5: 7,975,672 I78V probably benign Het
Taok2 T C 7: 126,871,443 K738E probably damaging Het
Tcea3 G A 4: 136,254,499 R56H probably damaging Het
Tcf20 A G 15: 82,852,525 V1575A probably damaging Het
Togaram1 T G 12: 64,980,632 S798R possibly damaging Het
Other mutations in Sulf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Sulf2 APN 2 166094492 missense possibly damaging 0.48
IGL01353:Sulf2 APN 2 166087095 missense probably damaging 1.00
IGL02427:Sulf2 APN 2 166089298 missense probably damaging 0.99
IGL02602:Sulf2 APN 2 166081300 missense probably benign 0.32
IGL02681:Sulf2 APN 2 166116985 missense probably benign 0.01
IGL03047:Sulf2 APN 2 166080894 splice site probably null
PIT4468001:Sulf2 UTSW 2 166080800 missense probably benign
R0029:Sulf2 UTSW 2 166116973 missense possibly damaging 0.46
R0029:Sulf2 UTSW 2 166116973 missense possibly damaging 0.46
R0233:Sulf2 UTSW 2 166085669 splice site probably benign
R0332:Sulf2 UTSW 2 166089199 missense probably benign 0.00
R0411:Sulf2 UTSW 2 166093516 missense probably damaging 1.00
R0599:Sulf2 UTSW 2 166083879 missense possibly damaging 0.53
R0694:Sulf2 UTSW 2 166085791 missense probably damaging 1.00
R1594:Sulf2 UTSW 2 166084447 splice site probably benign
R1710:Sulf2 UTSW 2 166079072 missense probably benign
R1725:Sulf2 UTSW 2 166081361 missense probably damaging 0.96
R1737:Sulf2 UTSW 2 166082678 missense probably benign 0.01
R1775:Sulf2 UTSW 2 166079612 missense probably benign 0.07
R2001:Sulf2 UTSW 2 166080853 missense probably benign 0.05
R2570:Sulf2 UTSW 2 166085801 missense probably benign 0.21
R4052:Sulf2 UTSW 2 166094590 missense probably damaging 1.00
R4357:Sulf2 UTSW 2 166077577 missense probably benign 0.01
R4613:Sulf2 UTSW 2 166132605 missense probably damaging 1.00
R4790:Sulf2 UTSW 2 166089295 missense probably damaging 1.00
R4858:Sulf2 UTSW 2 166081604 missense probably benign 0.00
R5033:Sulf2 UTSW 2 166081622 missense probably benign 0.01
R5692:Sulf2 UTSW 2 166081506 missense probably benign 0.03
R5695:Sulf2 UTSW 2 166132758 missense probably benign 0.03
R6504:Sulf2 UTSW 2 166083921 missense probably benign 0.00
R6816:Sulf2 UTSW 2 166082754 missense probably benign
R6859:Sulf2 UTSW 2 166087119 missense probably damaging 1.00
R6873:Sulf2 UTSW 2 166089275 missense probably damaging 0.97
R7125:Sulf2 UTSW 2 166075528 nonsense probably null
R7329:Sulf2 UTSW 2 166117088 missense probably damaging 1.00
R7343:Sulf2 UTSW 2 166077616 missense possibly damaging 0.69
R7669:Sulf2 UTSW 2 166093596 missense possibly damaging 0.67
R7833:Sulf2 UTSW 2 166079536 missense possibly damaging 0.92
R8421:Sulf2 UTSW 2 166117052 missense probably benign 0.11
R8430:Sulf2 UTSW 2 166074816 missense probably benign 0.03
R9285:Sulf2 UTSW 2 166093515 missense probably damaging 1.00
R9410:Sulf2 UTSW 2 166094524 missense
RF016:Sulf2 UTSW 2 166082603 missense probably benign 0.01
X0063:Sulf2 UTSW 2 166079133 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTGGCACCTGGAGTTTCTATG -3'
(R):5'- GGCAACTGTGGTGTCAGTAC -3'

Sequencing Primer
(F):5'- CACCTGGAGTTTCTATGGGGGTG -3'
(R):5'- GCAACTGTGGTGTCAGTACTAACTC -3'
Posted On 2021-07-15