Incidental Mutation 'R0731:Or8g34'
ID 67565
Institutional Source Beutler Lab
Gene Symbol Or8g34
Ensembl Gene ENSMUSG00000094745
Gene Name olfactory receptor family 8 subfamily G member 34
Synonyms GA_x6K02T2PVTD-33158015-33158950, MOR171-42, Olfr954, MOR171-53
MMRRC Submission 038912-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R0731 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 39372729-39373673 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39372828 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 34 (F34L)
Ref Sequence ENSEMBL: ENSMUSP00000079205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080329] [ENSMUST00000214818]
AlphaFold Q9EQB6
Predicted Effect probably damaging
Transcript: ENSMUST00000080329
AA Change: F34L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079205
Gene: ENSMUSG00000094745
AA Change: F34L

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 38 264 3e-5 PFAM
Pfam:7tm_1 44 293 1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214818
AA Change: F31L

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219910
Meta Mutation Damage Score 0.1583 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,367,247 (GRCm39) R27* probably null Het
Actg1 A G 11: 120,237,775 (GRCm39) F255S probably damaging Het
Ahdc1 T A 4: 132,790,262 (GRCm39) V501E possibly damaging Het
Alpk2 A T 18: 65,438,461 (GRCm39) D1444E probably damaging Het
Btaf1 T G 19: 36,974,895 (GRCm39) probably null Het
Cacnb2 A G 2: 14,990,517 (GRCm39) H489R possibly damaging Het
Ccdc162 C A 10: 41,455,139 (GRCm39) K398N probably damaging Het
Cd79b G T 11: 106,203,259 (GRCm39) S145R probably damaging Het
Cdh11 T A 8: 103,394,651 (GRCm39) N264Y probably damaging Het
Celsr1 T C 15: 85,785,798 (GRCm39) D2892G probably benign Het
Chuk A G 19: 44,092,205 (GRCm39) probably benign Het
Clk3 T C 9: 57,658,409 (GRCm39) probably benign Het
Dcaf8 A T 1: 172,000,076 (GRCm39) D78V possibly damaging Het
Dctn1 A G 6: 83,160,071 (GRCm39) T87A probably damaging Het
Ddx50 T C 10: 62,452,028 (GRCm39) N732D unknown Het
Dnah5 A T 15: 28,311,289 (GRCm39) Y1756F possibly damaging Het
Dock3 A T 9: 106,847,055 (GRCm39) V858E probably damaging Het
Fer1l4 A G 2: 155,865,990 (GRCm39) F1566S probably benign Het
Fpr-rs7 T C 17: 20,334,116 (GRCm39) I125V probably benign Het
Fuca2 C T 10: 13,381,771 (GRCm39) P228L probably benign Het
Galntl6 A G 8: 58,989,018 (GRCm39) F57L probably benign Het
Gigyf2 T A 1: 87,335,449 (GRCm39) probably benign Het
Gm16505 A T 13: 3,411,329 (GRCm39) noncoding transcript Het
Gm4781 T C 10: 100,232,639 (GRCm39) noncoding transcript Het
Gm9956 T A 10: 56,621,639 (GRCm39) Y100* probably null Het
Gpr137c T A 14: 45,483,806 (GRCm39) C178S probably damaging Het
Gpr83 A G 9: 14,779,940 (GRCm39) R331G probably benign Het
Hlcs T A 16: 93,932,711 (GRCm39) H851L probably damaging Het
Irag1 T C 7: 110,476,107 (GRCm39) S615G probably benign Het
Kbtbd6 C A 14: 79,689,324 (GRCm39) Y6* probably null Het
Kif23 T C 9: 61,832,314 (GRCm39) R610G possibly damaging Het
Kifc3 G A 8: 95,832,361 (GRCm39) T487I probably damaging Het
Klra5 A C 6: 129,885,759 (GRCm39) D133E possibly damaging Het
Klra6 T C 6: 129,999,668 (GRCm39) E100G probably damaging Het
Klre1 T A 6: 129,562,531 (GRCm39) probably benign Het
Lancl1 C T 1: 67,049,069 (GRCm39) probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Man1b1 A G 2: 25,228,167 (GRCm39) I146V possibly damaging Het
Map4k5 T A 12: 69,921,038 (GRCm39) probably benign Het
Mast3 A G 8: 71,233,965 (GRCm39) S178P probably damaging Het
Mau2 A G 8: 70,476,262 (GRCm39) probably null Het
Mgat4f A C 1: 134,317,713 (GRCm39) M162L probably benign Het
Mkrn2 A T 6: 115,591,612 (GRCm39) N312Y probably damaging Het
Myh1 A G 11: 67,093,359 (GRCm39) E150G probably damaging Het
Myo7b T A 18: 32,094,878 (GRCm39) probably null Het
Nyap1 A G 5: 137,733,560 (GRCm39) V491A probably damaging Het
Or10a3 A T 7: 108,480,740 (GRCm39) N24K probably damaging Het
Or4g17 A G 2: 111,209,638 (GRCm39) M98V probably damaging Het
Or5p60 T C 7: 107,723,941 (GRCm39) I176M probably benign Het
Oxsm A T 14: 16,240,893 (GRCm38) H385Q probably damaging Het
Pbld2 T C 10: 62,892,590 (GRCm39) S242P probably damaging Het
Pdzd7 T C 19: 45,017,744 (GRCm39) Y675C probably damaging Het
Pnkd T A 1: 74,390,700 (GRCm39) H266Q probably damaging Het
Rbfox2 A G 15: 76,983,479 (GRCm39) S141P probably benign Het
Rdx A G 9: 51,979,518 (GRCm39) T214A probably benign Het
Ripor2 A T 13: 24,864,627 (GRCm39) E219V probably damaging Het
Rlig1 T C 10: 100,422,065 (GRCm39) T66A probably damaging Het
Rufy2 G A 10: 62,847,623 (GRCm39) probably benign Het
Slf2 T A 19: 44,964,165 (GRCm39) probably benign Het
Snrnp200 G T 2: 127,068,065 (GRCm39) probably benign Het
Snx7 T A 3: 117,623,320 (GRCm39) probably benign Het
Stt3a T C 9: 36,646,808 (GRCm39) I602V probably damaging Het
Tacr3 G A 3: 134,560,761 (GRCm39) probably null Het
Tcerg1 C T 18: 42,704,905 (GRCm39) T978M probably damaging Het
Tcf7l1 G T 6: 72,765,252 (GRCm39) P126Q possibly damaging Het
Trank1 A G 9: 111,194,556 (GRCm39) D860G probably damaging Het
Try4 T C 6: 41,281,301 (GRCm39) L81P probably benign Het
Ucp1 T C 8: 84,024,476 (GRCm39) probably benign Het
Ugt2b38 G A 5: 87,568,311 (GRCm39) A328V probably damaging Het
Wfikkn1 T A 17: 26,096,991 (GRCm39) R444S probably damaging Het
Zfc3h1 A G 10: 115,246,537 (GRCm39) T875A probably benign Het
Zfp11 A G 5: 129,734,328 (GRCm39) S378P probably damaging Het
Zfp984 T A 4: 147,840,689 (GRCm39) N54I probably damaging Het
Other mutations in Or8g34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02704:Or8g34 APN 9 39,373,579 (GRCm39) missense probably damaging 0.98
IGL02793:Or8g34 APN 9 39,372,802 (GRCm39) missense probably benign 0.09
IGL02964:Or8g34 APN 9 39,373,077 (GRCm39) missense possibly damaging 0.88
IGL02979:Or8g34 APN 9 39,372,819 (GRCm39) missense probably benign 0.02
R0041:Or8g34 UTSW 9 39,372,772 (GRCm39) missense probably benign 0.34
R0153:Or8g34 UTSW 9 39,372,967 (GRCm39) missense probably damaging 0.99
R0269:Or8g34 UTSW 9 39,373,090 (GRCm39) missense probably damaging 1.00
R0426:Or8g34 UTSW 9 39,372,889 (GRCm39) missense probably damaging 1.00
R1800:Or8g34 UTSW 9 39,373,410 (GRCm39) missense probably damaging 1.00
R2340:Or8g34 UTSW 9 39,373,105 (GRCm39) missense probably damaging 1.00
R2901:Or8g34 UTSW 9 39,373,234 (GRCm39) missense probably damaging 0.97
R2912:Or8g34 UTSW 9 39,373,512 (GRCm39) missense probably damaging 1.00
R2939:Or8g34 UTSW 9 39,373,226 (GRCm39) missense probably benign 0.02
R2940:Or8g34 UTSW 9 39,373,226 (GRCm39) missense probably benign 0.02
R3081:Or8g34 UTSW 9 39,373,226 (GRCm39) missense probably benign 0.02
R3765:Or8g34 UTSW 9 39,372,920 (GRCm39) nonsense probably null
R4450:Or8g34 UTSW 9 39,373,328 (GRCm39) missense probably benign 0.00
R4515:Or8g34 UTSW 9 39,373,527 (GRCm39) nonsense probably null
R4786:Or8g34 UTSW 9 39,373,137 (GRCm39) missense probably benign 0.16
R4961:Or8g34 UTSW 9 39,373,183 (GRCm39) missense probably damaging 1.00
R5219:Or8g34 UTSW 9 39,373,563 (GRCm39) missense probably benign 0.09
R5602:Or8g34 UTSW 9 39,373,326 (GRCm39) missense probably benign 0.00
R5887:Or8g34 UTSW 9 39,372,787 (GRCm39) missense probably damaging 1.00
R5950:Or8g34 UTSW 9 39,373,633 (GRCm39) missense probably benign 0.01
R6943:Or8g34 UTSW 9 39,373,159 (GRCm39) missense probably benign 0.05
R7567:Or8g34 UTSW 9 39,373,173 (GRCm39) missense possibly damaging 0.92
R8817:Or8g34 UTSW 9 39,373,387 (GRCm39) missense probably damaging 1.00
R9251:Or8g34 UTSW 9 39,373,668 (GRCm39) missense probably benign
X0060:Or8g34 UTSW 9 39,373,570 (GRCm39) missense probably damaging 1.00
Z1177:Or8g34 UTSW 9 39,372,997 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGCACTTTCACTCGCTAATACAGAC -3'
(R):5'- GCTCACCAGCATTTTAGGGGTAACAAC -3'

Sequencing Primer
(F):5'- TTGAGACTTTGCAATGAAAGGATG -3'
(R):5'- CATTTTAGGGGTAACAACTGTGGAC -3'
Posted On 2013-09-03