Incidental Mutation 'R8861:Steap4'
ID675651
Institutional Source Beutler Lab
Gene Symbol Steap4
Ensembl Gene ENSMUSG00000012428
Gene NameSTEAP family member 4
SynonymsTiarp, Tnfaip9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R8861 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location7960457-7982213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7975672 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 78 (I78V)
Ref Sequence ENSEMBL: ENSMUSP00000111081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115421]
Predicted Effect probably benign
Transcript: ENSMUST00000115421
AA Change: I78V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000111081
Gene: ENSMUSG00000012428
AA Change: I78V

DomainStartEndE-ValueType
Pfam:F420_oxidored 21 107 2.3e-16 PFAM
transmembrane domain 203 225 N/A INTRINSIC
Pfam:Ferric_reduct 247 395 2.6e-14 PFAM
transmembrane domain 416 438 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit adipose accumulation, oxidative stress, increased liver weight, lower metabolic rate, hypoactivity, insulin resistance, glucose intolerance, mild hyperglycemia and dyslipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,259,961 K1168* probably null Het
Acly A G 11: 100,484,598 probably null Het
Agap2 T G 10: 127,090,514 V896G unknown Het
Agtpbp1 T C 13: 59,495,473 Y724C probably damaging Het
Angpt4 A G 2: 151,925,453 N135D probably damaging Het
Aox3 T A 1: 58,150,301 I387K probably benign Het
Bysl T C 17: 47,606,959 E103G probably benign Het
Chmp5 T A 4: 40,964,608 V208E probably damaging Het
Chst9 T G 18: 15,452,573 H311P possibly damaging Het
Dcaf11 C A 14: 55,564,498 Y235* probably null Het
Dlx5 A C 6: 6,878,233 S266A probably benign Het
Dnah7b T A 1: 46,241,076 S2722T possibly damaging Het
En2 T A 5: 28,166,735 I70N probably damaging Het
Fam72a T C 1: 131,538,918 Y147H possibly damaging Het
Fermt2 A T 14: 45,460,009 F628L possibly damaging Het
Fkrp T A 7: 16,810,824 D371V probably damaging Het
Fmn1 T C 2: 113,364,804 L283P unknown Het
Gm13271 G A 4: 88,755,129 V88I probably benign Het
Gnmt G A 17: 46,726,692 T120M probably damaging Het
H2-T22 A T 17: 36,042,398 V10D possibly damaging Het
Ick T A 9: 78,164,562 N505K probably benign Het
Igf2bp3 A C 6: 49,105,616 M344R possibly damaging Het
Kdm1b T C 13: 47,064,106 V347A probably benign Het
Klra17 A T 6: 129,874,902 S2R probably damaging Het
Klri1 A G 6: 129,698,201 S199P probably benign Het
Ltk T A 2: 119,759,613 Q44L probably benign Het
Matn4 A T 2: 164,392,905 Y549N Het
Mcoln3 T A 3: 146,139,404 F452I probably damaging Het
Mipol1 T C 12: 57,306,016 V47A probably benign Het
Msh4 A G 3: 153,901,468 L145S probably benign Het
Myh11 A T 16: 14,246,782 I224N Het
Nat8f1 A G 6: 85,910,462 L172P probably damaging Het
Ncoa7 T A 10: 30,691,368 K438I probably benign Het
Nr1h3 T G 2: 91,193,681 probably benign Het
Nuggc T C 14: 65,610,035 probably null Het
Olfr1036 A G 2: 86,075,616 N292S probably damaging Het
Olfr1271 T C 2: 90,266,459 probably benign Het
Olfr871 A T 9: 20,213,081 H244L probably damaging Het
Pfn4 T A 12: 4,775,456 Y98N probably benign Het
Ppp6r2 T G 15: 89,259,165 C172G probably damaging Het
Ptprk A G 10: 28,570,190 D979G probably damaging Het
Rbm28 A G 6: 29,152,285 I329T probably damaging Het
Rnf144a T C 12: 26,339,344 T33A probably damaging Het
Rnf145 A G 11: 44,555,157 T273A probably damaging Het
Rnf213 G A 11: 119,442,236 R2758H Het
Slc22a19 A T 19: 7,682,959 M362K possibly damaging Het
Slc29a4 G C 5: 142,718,825 R374P probably damaging Het
Slc43a1 A G 2: 84,861,404 T528A possibly damaging Het
Sp3 A T 2: 72,971,286 Y172N probably damaging Het
Srpr T A 9: 35,215,749 M573K probably benign Het
Sulf2 A G 2: 166,132,686 L26P possibly damaging Het
Taok2 T C 7: 126,871,443 K738E probably damaging Het
Tcea3 G A 4: 136,254,499 R56H probably damaging Het
Tcf20 A G 15: 82,852,525 V1575A probably damaging Het
Togaram1 T G 12: 64,980,632 S798R possibly damaging Het
Other mutations in Steap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Steap4 APN 5 7976979 missense probably damaging 1.00
IGL00827:Steap4 APN 5 7976712 missense probably damaging 1.00
IGL01481:Steap4 APN 5 7976858 missense probably damaging 0.98
IGL02378:Steap4 APN 5 7976741 missense probably benign 0.00
IGL03058:Steap4 APN 5 7975664 missense probably benign 0.00
PIT4362001:Steap4 UTSW 5 7980337 missense probably benign 0.03
R0329:Steap4 UTSW 5 7975829 missense possibly damaging 0.92
R0546:Steap4 UTSW 5 7975870 missense probably damaging 0.99
R0637:Steap4 UTSW 5 7978398 splice site probably benign
R0638:Steap4 UTSW 5 7977030 splice site probably benign
R0651:Steap4 UTSW 5 7980348 nonsense probably null
R0881:Steap4 UTSW 5 7980388 missense probably benign
R1167:Steap4 UTSW 5 7976520 missense probably benign 0.34
R1543:Steap4 UTSW 5 7975902 splice site probably benign
R1889:Steap4 UTSW 5 7975892 missense probably damaging 1.00
R3803:Steap4 UTSW 5 7976979 missense probably damaging 1.00
R3811:Steap4 UTSW 5 7977017 missense probably benign 0.18
R3885:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R3887:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R4051:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R4208:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R5016:Steap4 UTSW 5 7976699 nonsense probably null
R5302:Steap4 UTSW 5 7975547 nonsense probably null
R5951:Steap4 UTSW 5 7975769 missense probably benign 0.00
R6136:Steap4 UTSW 5 7978562 missense probably damaging 0.99
R6527:Steap4 UTSW 5 7978502 missense probably damaging 0.99
R6631:Steap4 UTSW 5 7976995 nonsense probably null
R6964:Steap4 UTSW 5 7975568 missense probably damaging 1.00
R7055:Steap4 UTSW 5 7976858 missense probably damaging 1.00
R7408:Steap4 UTSW 5 7978453 missense probably benign 0.07
R7692:Steap4 UTSW 5 7976976 missense probably benign 0.32
R8205:Steap4 UTSW 5 7976795 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AAAGCAAGGGGTTGTCTGC -3'
(R):5'- GCTTGCATCTAGTGTTCCTGAC -3'

Sequencing Primer
(F):5'- CTGCATTTTCGGAACAGGAG -3'
(R):5'- GAGATGGTGTTAAATGCTTTGACCAC -3'
Posted On2021-07-15