Incidental Mutation 'R0731:Clk3'
ID67567
Institutional Source Beutler Lab
Gene Symbol Clk3
Ensembl Gene ENSMUSG00000032316
Gene NameCDC-like kinase 3
Synonyms
MMRRC Submission 038912-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock #R0731 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57750624-57765860 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 57751126 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000043990] [ENSMUST00000065330] [ENSMUST00000137245]
Predicted Effect probably benign
Transcript: ENSMUST00000043990
SMART Domains Protein: ENSMUSP00000049146
Gene: ENSMUSG00000038957

DomainStartEndE-ValueType
LSM14 1 80 9.12e-20 SMART
Pfam:Edc3_linker 102 197 1.9e-47 PFAM
FDF 198 301 1.84e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065330
SMART Domains Protein: ENSMUSP00000067341
Gene: ENSMUSG00000032316

DomainStartEndE-ValueType
low complexity region 57 73 N/A INTRINSIC
low complexity region 122 147 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
low complexity region 181 199 N/A INTRINSIC
low complexity region 234 252 N/A INTRINSIC
low complexity region 261 283 N/A INTRINSIC
S_TKc 304 620 5.56e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137245
SMART Domains Protein: ENSMUSP00000123317
Gene: ENSMUSG00000038957

DomainStartEndE-ValueType
Pfam:LSM14 1 56 3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215109
Predicted Effect probably benign
Transcript: ENSMUST00000215233
Predicted Effect probably benign
Transcript: ENSMUST00000215333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216095
Predicted Effect probably benign
Transcript: ENSMUST00000217409
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the serine/threonine type protein kinase family. This protein is a nuclear dual-specificity kinase that regulates the intranuclear distribution of the serine/arginine-rich (SR) family of splicing factors. Two transcript variants encoding different isoforms have been found for this gene. Related pseudogenes are located on chromosomes 1 and 9. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,586,203 T66A probably damaging Het
4933406M09Rik A C 1: 134,389,975 M162L probably benign Het
Acsm3 A T 7: 119,768,024 R27* probably null Het
Actg1 A G 11: 120,346,949 F255S probably damaging Het
Ahdc1 T A 4: 133,062,951 V501E possibly damaging Het
Alpk2 A T 18: 65,305,390 D1444E probably damaging Het
Btaf1 T G 19: 36,997,495 probably null Het
Cacnb2 A G 2: 14,985,706 H489R possibly damaging Het
Ccdc162 C A 10: 41,579,143 K398N probably damaging Het
Cd79b G T 11: 106,312,433 S145R probably damaging Het
Cdh11 T A 8: 102,668,019 N264Y probably damaging Het
Celsr1 T C 15: 85,901,597 D2892G probably benign Het
Chuk A G 19: 44,103,766 probably benign Het
Dcaf8 A T 1: 172,172,509 D78V possibly damaging Het
Dctn1 A G 6: 83,183,089 T87A probably damaging Het
Ddx50 T C 10: 62,616,249 N732D unknown Het
Dnah5 A T 15: 28,311,143 Y1756F possibly damaging Het
Dock3 A T 9: 106,969,856 V858E probably damaging Het
Fer1l4 A G 2: 156,024,070 F1566S probably benign Het
Fpr-rs7 T C 17: 20,113,854 I125V probably benign Het
Fuca2 C T 10: 13,506,027 P228L probably benign Het
Galntl6 A G 8: 58,535,984 F57L probably benign Het
Gigyf2 T A 1: 87,407,727 probably benign Het
Gm16505 A T 13: 3,361,329 noncoding transcript Het
Gm4781 T C 10: 100,396,777 noncoding transcript Het
Gm9956 T A 10: 56,745,543 Y100* probably null Het
Gpr137c T A 14: 45,246,349 C178S probably damaging Het
Gpr83 A G 9: 14,868,644 R331G probably benign Het
Hlcs T A 16: 94,131,852 H851L probably damaging Het
Kbtbd6 C A 14: 79,451,884 Y6* probably null Het
Kif23 T C 9: 61,925,032 R610G possibly damaging Het
Kifc3 G A 8: 95,105,733 T487I probably damaging Het
Klra5 A C 6: 129,908,796 D133E possibly damaging Het
Klra6 T C 6: 130,022,705 E100G probably damaging Het
Klre1 T A 6: 129,585,568 probably benign Het
Lancl1 C T 1: 67,009,910 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Man1b1 A G 2: 25,338,155 I146V possibly damaging Het
Map4k5 T A 12: 69,874,264 probably benign Het
Mast3 A G 8: 70,781,321 S178P probably damaging Het
Mau2 A G 8: 70,023,612 probably null Het
Mkrn2 A T 6: 115,614,651 N312Y probably damaging Het
Mrvi1 T C 7: 110,876,900 S615G probably benign Het
Myh1 A G 11: 67,202,533 E150G probably damaging Het
Myo7b T A 18: 31,961,825 probably null Het
Nyap1 A G 5: 137,735,298 V491A probably damaging Het
Olfr1284 A G 2: 111,379,293 M98V probably damaging Het
Olfr484 T C 7: 108,124,734 I176M probably benign Het
Olfr518 A T 7: 108,881,533 N24K probably damaging Het
Olfr954 T C 9: 39,461,532 F34L probably damaging Het
Oxsm A T 14: 16,240,893 H385Q probably damaging Het
Pbld2 T C 10: 63,056,811 S242P probably damaging Het
Pdzd7 T C 19: 45,029,305 Y675C probably damaging Het
Pnkd T A 1: 74,351,541 H266Q probably damaging Het
Rbfox2 A G 15: 77,099,279 S141P probably benign Het
Rdx A G 9: 52,068,218 T214A probably benign Het
Ripor2 A T 13: 24,680,644 E219V probably damaging Het
Rufy2 G A 10: 63,011,844 probably benign Het
Slf2 T A 19: 44,975,726 probably benign Het
Snrnp200 G T 2: 127,226,145 probably benign Het
Snx7 T A 3: 117,829,671 probably benign Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Tacr3 G A 3: 134,855,000 probably null Het
Tcerg1 C T 18: 42,571,840 T978M probably damaging Het
Tcf7l1 G T 6: 72,788,269 P126Q possibly damaging Het
Trank1 A G 9: 111,365,488 D860G probably damaging Het
Try4 T C 6: 41,304,367 L81P probably benign Het
Ucp1 T C 8: 83,297,847 probably benign Het
Ugt2b38 G A 5: 87,420,452 A328V probably damaging Het
Wfikkn1 T A 17: 25,878,017 R444S probably damaging Het
Zfc3h1 A G 10: 115,410,632 T875A probably benign Het
Zfp11 A G 5: 129,657,264 S378P probably damaging Het
Zfp984 T A 4: 147,756,232 N54I probably damaging Het
Other mutations in Clk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Clk3 APN 9 57754592 missense probably damaging 1.00
IGL01654:Clk3 APN 9 57751763 missense probably damaging 1.00
IGL02506:Clk3 APN 9 57754644 nonsense probably null
R0062:Clk3 UTSW 9 57752166 missense probably damaging 1.00
R0062:Clk3 UTSW 9 57752166 missense probably damaging 1.00
R1944:Clk3 UTSW 9 57765186 missense probably benign 0.27
R2060:Clk3 UTSW 9 57751117 missense probably damaging 1.00
R2362:Clk3 UTSW 9 57754619 missense possibly damaging 0.90
R4380:Clk3 UTSW 9 57751792 missense probably damaging 1.00
R5395:Clk3 UTSW 9 57753339 missense probably damaging 1.00
R5422:Clk3 UTSW 9 57765438 missense probably benign
R6652:Clk3 UTSW 9 57761795 missense probably damaging 0.99
R6828:Clk3 UTSW 9 57760849 missense possibly damaging 0.87
R6933:Clk3 UTSW 9 57761849 missense probably damaging 1.00
R7343:Clk3 UTSW 9 57760956 missense probably damaging 0.97
R7585:Clk3 UTSW 9 57761836 missense probably damaging 1.00
R8395:Clk3 UTSW 9 57765162 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCAAACCACACTTGGCTTTC -3'
(R):5'- AGATCCCACCCAGTAGCCTAAGTTC -3'

Sequencing Primer
(F):5'- CCTGGAGATGGACACACTG -3'
(R):5'- TAGCCTAAGTTCTGAGCATGAAAG -3'
Posted On2013-09-03