Incidental Mutation 'R8861:Mipol1'
ID 675674
Institutional Source Beutler Lab
Gene Symbol Mipol1
Ensembl Gene ENSMUSG00000047022
Gene Name mirror-image polydactyly 1
Synonyms 1700081O04Rik, 6030439O22Rik, D12Ertd19e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8861 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 57230427-57497199 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57306016 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 47 (V47A)
Ref Sequence ENSEMBL: ENSMUSP00000121617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447] [ENSMUST00000145003] [ENSMUST00000153137]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000123498
AA Change: V47A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022
AA Change: V47A

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130447
AA Change: V47A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022
AA Change: V47A

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000145003
AA Change: V47A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121617
Gene: ENSMUSG00000047022
AA Change: V47A

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153137
AA Change: V47A

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117005
Gene: ENSMUSG00000047022
AA Change: V47A

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,259,961 K1168* probably null Het
Acly A G 11: 100,484,598 probably null Het
Agap2 T G 10: 127,090,514 V896G unknown Het
Agtpbp1 T C 13: 59,495,473 Y724C probably damaging Het
Angpt4 A G 2: 151,925,453 N135D probably damaging Het
Aox3 T A 1: 58,150,301 I387K probably benign Het
Bysl T C 17: 47,606,959 E103G probably benign Het
Chmp5 T A 4: 40,964,608 V208E probably damaging Het
Chst9 T G 18: 15,452,573 H311P possibly damaging Het
Dcaf11 C A 14: 55,564,498 Y235* probably null Het
Dlx5 A C 6: 6,878,233 S266A probably benign Het
Dnah7b T A 1: 46,241,076 S2722T possibly damaging Het
En2 T A 5: 28,166,735 I70N probably damaging Het
Fam72a T C 1: 131,538,918 Y147H possibly damaging Het
Fermt2 A T 14: 45,460,009 F628L possibly damaging Het
Fkrp T A 7: 16,810,824 D371V probably damaging Het
Fmn1 T C 2: 113,364,804 L283P unknown Het
Gm13271 G A 4: 88,755,129 V88I probably benign Het
Gnmt G A 17: 46,726,692 T120M probably damaging Het
H2-T22 A T 17: 36,042,398 V10D possibly damaging Het
Ick T A 9: 78,164,562 N505K probably benign Het
Igf2bp3 A C 6: 49,105,616 M344R possibly damaging Het
Kdm1b T C 13: 47,064,106 V347A probably benign Het
Klra17 A T 6: 129,874,902 S2R probably damaging Het
Klri1 A G 6: 129,698,201 S199P probably benign Het
Ltk T A 2: 119,759,613 Q44L probably benign Het
Matn4 A T 2: 164,392,905 Y549N Het
Mcoln3 T A 3: 146,139,404 F452I probably damaging Het
Msh4 A G 3: 153,901,468 L145S probably benign Het
Myh11 A T 16: 14,246,782 I224N Het
Nat8f1 A G 6: 85,910,462 L172P probably damaging Het
Ncoa7 T A 10: 30,691,368 K438I probably benign Het
Nr1h3 T G 2: 91,193,681 probably benign Het
Nuggc T C 14: 65,610,035 probably null Het
Olfr1036 A G 2: 86,075,616 N292S probably damaging Het
Olfr1271 T C 2: 90,266,459 probably benign Het
Olfr871 A T 9: 20,213,081 H244L probably damaging Het
Pfn4 T A 12: 4,775,456 Y98N probably benign Het
Ppp6r2 T G 15: 89,259,165 C172G probably damaging Het
Ptprk A G 10: 28,570,190 D979G probably damaging Het
Rbm28 A G 6: 29,152,285 I329T probably damaging Het
Rnf144a T C 12: 26,339,344 T33A probably damaging Het
Rnf145 A G 11: 44,555,157 T273A probably damaging Het
Rnf213 G A 11: 119,442,236 R2758H Het
Slc22a19 A T 19: 7,682,959 M362K possibly damaging Het
Slc29a4 G C 5: 142,718,825 R374P probably damaging Het
Slc43a1 A G 2: 84,861,404 T528A possibly damaging Het
Sp3 A T 2: 72,971,286 Y172N probably damaging Het
Srpr T A 9: 35,215,749 M573K probably benign Het
Steap4 A G 5: 7,975,672 I78V probably benign Het
Sulf2 A G 2: 166,132,686 L26P possibly damaging Het
Taok2 T C 7: 126,871,443 K738E probably damaging Het
Tcea3 G A 4: 136,254,499 R56H probably damaging Het
Tcf20 A G 15: 82,852,525 V1575A probably damaging Het
Togaram1 T G 12: 64,980,632 S798R possibly damaging Het
Other mutations in Mipol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mipol1 APN 12 57307353 splice site probably benign
IGL01139:Mipol1 APN 12 57306035 nonsense probably null
IGL02679:Mipol1 APN 12 57306043 missense possibly damaging 0.84
IGL03109:Mipol1 APN 12 57364224 missense probably benign 0.20
R0001:Mipol1 UTSW 12 57460839 splice site probably benign
R0220:Mipol1 UTSW 12 57457150 missense probably damaging 1.00
R0271:Mipol1 UTSW 12 57460954 unclassified probably benign
R0284:Mipol1 UTSW 12 57457069 missense probably damaging 0.98
R0496:Mipol1 UTSW 12 57457177 missense probably damaging 0.99
R0538:Mipol1 UTSW 12 57414411 critical splice donor site probably null
R1082:Mipol1 UTSW 12 57325616 missense probably damaging 0.98
R1552:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R1558:Mipol1 UTSW 12 57332341 missense probably damaging 1.00
R1928:Mipol1 UTSW 12 57332419 missense probably damaging 1.00
R2104:Mipol1 UTSW 12 57306056 splice site probably null
R2495:Mipol1 UTSW 12 57460990 splice site probably benign
R3723:Mipol1 UTSW 12 57457092 missense probably damaging 1.00
R4431:Mipol1 UTSW 12 57303524 missense possibly damaging 0.58
R4447:Mipol1 UTSW 12 57352748 intron probably benign
R4654:Mipol1 UTSW 12 57306132 missense probably benign 0.22
R4847:Mipol1 UTSW 12 57303496 missense probably damaging 0.99
R4851:Mipol1 UTSW 12 57332301 missense probably damaging 1.00
R5113:Mipol1 UTSW 12 57496499 missense probably benign 0.36
R5668:Mipol1 UTSW 12 57325560 missense possibly damaging 0.48
R6535:Mipol1 UTSW 12 57306100 missense possibly damaging 0.95
R7172:Mipol1 UTSW 12 57325535 missense possibly damaging 0.95
R7191:Mipol1 UTSW 12 57457066 missense probably benign 0.01
R7560:Mipol1 UTSW 12 57306073 missense possibly damaging 0.94
R8508:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R8752:Mipol1 UTSW 12 57325581 missense probably damaging 1.00
R8772:Mipol1 UTSW 12 57325632 missense probably benign 0.23
R8928:Mipol1 UTSW 12 57460865 missense probably benign 0.00
R9011:Mipol1 UTSW 12 57457079 missense probably benign 0.03
R9250:Mipol1 UTSW 12 57414383 missense probably damaging 1.00
R9383:Mipol1 UTSW 12 57306034 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGAGTCTCTTTTGGGATCACT -3'
(R):5'- ACAACAGAGAAAACTGGAACTGT -3'

Sequencing Primer
(F):5'- AGTCTCTTTTGGGATCACTGTGTG -3'
(R):5'- CTTGCTCTGAGAATTTCCAA -3'
Posted On 2021-07-15