Mutagenetix > Incidental Mutations

Incidental Mutation 'R0731:Kif23'

67568

Institutional Source

Beutler Lab

Gene Symbol

Kif23

Ensembl Gene

ENSMUSG00000032254

Gene Name

kinesin family member 23

Synonyms

MKLP-1, Knsl5, C87313, 3110001D19Rik, MKLP1, CHO1

MMRRC Submission

038912-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R0731 (G1)

Quality Score

195

Status

Validated

Chromosome

Chromosomal Location

61915905-61946774 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 61925032 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 610 (R610G)

Ref Sequence

ENSEMBL: ENSMUSP00000034815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034815] [ENSMUST00000214295]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034815
AA Change: R610G

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000034815
Gene: ENSMUSG00000032254
AA Change: R610G

Domain	Start	End	E-Value	Type
KISc	23	444	6.56e-147	SMART
Blast:KISc	524	607	8e-20	BLAST
low complexity region	661	678	N/A	INTRINSIC
low complexity region	681	693	N/A	INTRINSIC
low complexity region	715	728	N/A	INTRINSIC
Pfam:MKLP1_Arf_bdg	796	899	9.2e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213159

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213595

Predicted Effect

probably benign
Transcript: ENSMUST00000214295

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214940

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215319

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215743

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215965

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216717

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216746

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216812

Meta Mutation Damage Score

0.1412

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of kinesin-like protein family. This family includes microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. This protein has been shown to cross-bridge antiparallel microtubules and drive microtubule movement in vitro. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430F08Rik	T	C	10: 100,586,203	T66A	probably damaging	Het
4933406M09Rik	A	C	1: 134,389,975	M162L	probably benign	Het
Acsm3	A	T	7: 119,768,024	R27*	probably null	Het
Actg1	A	G	11: 120,346,949	F255S	probably damaging	Het
Ahdc1	T	A	4: 133,062,951	V501E	possibly damaging	Het
Alpk2	A	T	18: 65,305,390	D1444E	probably damaging	Het
Btaf1	T	G	19: 36,997,495		probably null	Het
Cacnb2	A	G	2: 14,985,706	H489R	possibly damaging	Het
Ccdc162	C	A	10: 41,579,143	K398N	probably damaging	Het
Cd79b	G	T	11: 106,312,433	S145R	probably damaging	Het
Cdh11	T	A	8: 102,668,019	N264Y	probably damaging	Het
Celsr1	T	C	15: 85,901,597	D2892G	probably benign	Het
Chuk	A	G	19: 44,103,766		probably benign	Het
Clk3	T	C	9: 57,751,126		probably benign	Het
Dcaf8	A	T	1: 172,172,509	D78V	possibly damaging	Het
Dctn1	A	G	6: 83,183,089	T87A	probably damaging	Het
Ddx50	T	C	10: 62,616,249	N732D	unknown	Het
Dnah5	A	T	15: 28,311,143	Y1756F	possibly damaging	Het
Dock3	A	T	9: 106,969,856	V858E	probably damaging	Het
Fer1l4	A	G	2: 156,024,070	F1566S	probably benign	Het
Fpr-rs7	T	C	17: 20,113,854	I125V	probably benign	Het
Fuca2	C	T	10: 13,506,027	P228L	probably benign	Het
Galntl6	A	G	8: 58,535,984	F57L	probably benign	Het
Gigyf2	T	A	1: 87,407,727		probably benign	Het
Gm16505	A	T	13: 3,361,329		noncoding transcript	Het
Gm4781	T	C	10: 100,396,777		noncoding transcript	Het
Gm9956	T	A	10: 56,745,543	Y100*	probably null	Het
Gpr137c	T	A	14: 45,246,349	C178S	probably damaging	Het
Gpr83	A	G	9: 14,868,644	R331G	probably benign	Het
Hlcs	T	A	16: 94,131,852	H851L	probably damaging	Het
Kbtbd6	C	A	14: 79,451,884	Y6*	probably null	Het
Kifc3	G	A	8: 95,105,733	T487I	probably damaging	Het
Klra5	A	C	6: 129,908,796	D133E	possibly damaging	Het
Klra6	T	C	6: 130,022,705	E100G	probably damaging	Het
Klre1	T	A	6: 129,585,568		probably benign	Het
Lancl1	C	T	1: 67,009,910		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Man1b1	A	G	2: 25,338,155	I146V	possibly damaging	Het
Map4k5	T	A	12: 69,874,264		probably benign	Het
Mast3	A	G	8: 70,781,321	S178P	probably damaging	Het
Mau2	A	G	8: 70,023,612		probably null	Het
Mkrn2	A	T	6: 115,614,651	N312Y	probably damaging	Het
Mrvi1	T	C	7: 110,876,900	S615G	probably benign	Het
Myh1	A	G	11: 67,202,533	E150G	probably damaging	Het
Myo7b	T	A	18: 31,961,825		probably null	Het
Nyap1	A	G	5: 137,735,298	V491A	probably damaging	Het
Olfr1284	A	G	2: 111,379,293	M98V	probably damaging	Het
Olfr484	T	C	7: 108,124,734	I176M	probably benign	Het
Olfr518	A	T	7: 108,881,533	N24K	probably damaging	Het
Olfr954	T	C	9: 39,461,532	F34L	probably damaging	Het
Oxsm	A	T	14: 16,240,893	H385Q	probably damaging	Het
Pbld2	T	C	10: 63,056,811	S242P	probably damaging	Het
Pdzd7	T	C	19: 45,029,305	Y675C	probably damaging	Het
Pnkd	T	A	1: 74,351,541	H266Q	probably damaging	Het
Rbfox2	A	G	15: 77,099,279	S141P	probably benign	Het
Rdx	A	G	9: 52,068,218	T214A	probably benign	Het
Ripor2	A	T	13: 24,680,644	E219V	probably damaging	Het
Rufy2	G	A	10: 63,011,844		probably benign	Het
Slf2	T	A	19: 44,975,726		probably benign	Het
Snrnp200	G	T	2: 127,226,145		probably benign	Het
Snx7	T	A	3: 117,829,671		probably benign	Het
Stt3a	T	C	9: 36,735,512	I602V	probably damaging	Het
Tacr3	G	A	3: 134,855,000		probably null	Het
Tcerg1	C	T	18: 42,571,840	T978M	probably damaging	Het
Tcf7l1	G	T	6: 72,788,269	P126Q	possibly damaging	Het
Trank1	A	G	9: 111,365,488	D860G	probably damaging	Het
Try4	T	C	6: 41,304,367	L81P	probably benign	Het
Ucp1	T	C	8: 83,297,847		probably benign	Het
Ugt2b38	G	A	5: 87,420,452	A328V	probably damaging	Het
Wfikkn1	T	A	17: 25,878,017	R444S	probably damaging	Het
Zfc3h1	A	G	10: 115,410,632	T875A	probably benign	Het
Zfp11	A	G	5: 129,657,264	S378P	probably damaging	Het
Zfp984	T	A	4: 147,756,232	N54I	probably damaging	Het

Other mutations in Kif23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Kif23	APN	9	61926468	missense	probably benign	0.19
IGL00814:Kif23	APN	9	61937107	missense	possibly damaging	0.95
IGL01295:Kif23	APN	9	61932129	missense	possibly damaging	0.89
IGL01521:Kif23	APN	9	61919900	missense	probably damaging	0.99
IGL01583:Kif23	APN	9	61935468	missense	probably damaging	1.00
IGL01680:Kif23	APN	9	61931814	missense	probably benign	0.17
IGL02450:Kif23	APN	9	61923957	missense	probably benign	0.00
IGL02698:Kif23	APN	9	61925001	missense	possibly damaging	0.49
IGL03152:Kif23	APN	9	61929776	splice site	probably benign
IGL03233:Kif23	APN	9	61926453	missense	probably benign	0.05
H8562:Kif23	UTSW	9	61924065	missense	probably benign
R0225:Kif23	UTSW	9	61925694	splice site	probably benign
R0419:Kif23	UTSW	9	61926405	nonsense	probably null
R0512:Kif23	UTSW	9	61918975	splice site	probably benign
R0980:Kif23	UTSW	9	61936764	missense	possibly damaging	0.93
R1315:Kif23	UTSW	9	61923988	unclassified	probably null
R1347:Kif23	UTSW	9	61927156	missense	probably damaging	0.99
R1347:Kif23	UTSW	9	61927156	missense	probably damaging	0.99
R1451:Kif23	UTSW	9	61924802	missense	probably damaging	1.00
R1624:Kif23	UTSW	9	61925700	splice site	probably null
R1820:Kif23	UTSW	9	61926438	missense	possibly damaging	0.67
R1867:Kif23	UTSW	9	61918961	missense	possibly damaging	0.87
R1937:Kif23	UTSW	9	61946610	critical splice donor site	probably null
R2001:Kif23	UTSW	9	61927384	nonsense	probably null
R2002:Kif23	UTSW	9	61927384	nonsense	probably null
R2310:Kif23	UTSW	9	61924144	missense	probably damaging	1.00
R2680:Kif23	UTSW	9	61937476	missense	probably benign	0.25
R3196:Kif23	UTSW	9	61931911	nonsense	probably null
R3774:Kif23	UTSW	9	61924992	missense	probably benign	0.00
R3775:Kif23	UTSW	9	61924992	missense	probably benign	0.00
R3776:Kif23	UTSW	9	61924992	missense	probably benign	0.00
R4349:Kif23	UTSW	9	61932114	missense	probably damaging	1.00
R4671:Kif23	UTSW	9	61945359	missense	probably benign	0.04
R4981:Kif23	UTSW	9	61931871	missense	probably damaging	1.00
R4983:Kif23	UTSW	9	61936703	missense	probably benign	0.01
R5685:Kif23	UTSW	9	61945409	missense	probably benign	0.12
R5721:Kif23	UTSW	9	61944216	missense	probably benign	0.45
R6903:Kif23	UTSW	9	61927154	missense	possibly damaging	0.77
R7067:Kif23	UTSW	9	61924989	missense	probably benign	0.01
R7103:Kif23	UTSW	9	61919892	missense	probably damaging	0.99
R7456:Kif23	UTSW	9	61937120	missense	probably benign	0.09
R7468:Kif23	UTSW	9	61937175	nonsense	probably null
Z1177:Kif23	UTSW	9	61924163	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GACGCTCCTACAGAGAGCAATGAC -3'
(R):5'- TGCAGGTGAGTGTGTCCACAAG -3'

Sequencing Primer
(F):5'- GCAATGACAACTCAGTCTACTTTAG -3'
(R):5'- AAGGGCTATTTCTTCTACAGTTAGG -3'

Posted On

2013-09-03