Incidental Mutation 'R0731:Kif23'
ID67568
Institutional Source Beutler Lab
Gene Symbol Kif23
Ensembl Gene ENSMUSG00000032254
Gene Namekinesin family member 23
SynonymsMKLP-1, Knsl5, C87313, 3110001D19Rik, MKLP1, CHO1
MMRRC Submission 038912-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R0731 (G1)
Quality Score195
Status Validated
Chromosome9
Chromosomal Location61915905-61946774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61925032 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 610 (R610G)
Ref Sequence ENSEMBL: ENSMUSP00000034815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034815] [ENSMUST00000214295]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034815
AA Change: R610G

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034815
Gene: ENSMUSG00000032254
AA Change: R610G

DomainStartEndE-ValueType
KISc 23 444 6.56e-147 SMART
Blast:KISc 524 607 8e-20 BLAST
low complexity region 661 678 N/A INTRINSIC
low complexity region 681 693 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
Pfam:MKLP1_Arf_bdg 796 899 9.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213595
Predicted Effect probably benign
Transcript: ENSMUST00000214295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216812
Meta Mutation Damage Score 0.1412 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of kinesin-like protein family. This family includes microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. This protein has been shown to cross-bridge antiparallel microtubules and drive microtubule movement in vitro. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,586,203 T66A probably damaging Het
4933406M09Rik A C 1: 134,389,975 M162L probably benign Het
Acsm3 A T 7: 119,768,024 R27* probably null Het
Actg1 A G 11: 120,346,949 F255S probably damaging Het
Ahdc1 T A 4: 133,062,951 V501E possibly damaging Het
Alpk2 A T 18: 65,305,390 D1444E probably damaging Het
Btaf1 T G 19: 36,997,495 probably null Het
Cacnb2 A G 2: 14,985,706 H489R possibly damaging Het
Ccdc162 C A 10: 41,579,143 K398N probably damaging Het
Cd79b G T 11: 106,312,433 S145R probably damaging Het
Cdh11 T A 8: 102,668,019 N264Y probably damaging Het
Celsr1 T C 15: 85,901,597 D2892G probably benign Het
Chuk A G 19: 44,103,766 probably benign Het
Clk3 T C 9: 57,751,126 probably benign Het
Dcaf8 A T 1: 172,172,509 D78V possibly damaging Het
Dctn1 A G 6: 83,183,089 T87A probably damaging Het
Ddx50 T C 10: 62,616,249 N732D unknown Het
Dnah5 A T 15: 28,311,143 Y1756F possibly damaging Het
Dock3 A T 9: 106,969,856 V858E probably damaging Het
Fer1l4 A G 2: 156,024,070 F1566S probably benign Het
Fpr-rs7 T C 17: 20,113,854 I125V probably benign Het
Fuca2 C T 10: 13,506,027 P228L probably benign Het
Galntl6 A G 8: 58,535,984 F57L probably benign Het
Gigyf2 T A 1: 87,407,727 probably benign Het
Gm16505 A T 13: 3,361,329 noncoding transcript Het
Gm4781 T C 10: 100,396,777 noncoding transcript Het
Gm9956 T A 10: 56,745,543 Y100* probably null Het
Gpr137c T A 14: 45,246,349 C178S probably damaging Het
Gpr83 A G 9: 14,868,644 R331G probably benign Het
Hlcs T A 16: 94,131,852 H851L probably damaging Het
Kbtbd6 C A 14: 79,451,884 Y6* probably null Het
Kifc3 G A 8: 95,105,733 T487I probably damaging Het
Klra5 A C 6: 129,908,796 D133E possibly damaging Het
Klra6 T C 6: 130,022,705 E100G probably damaging Het
Klre1 T A 6: 129,585,568 probably benign Het
Lancl1 C T 1: 67,009,910 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Man1b1 A G 2: 25,338,155 I146V possibly damaging Het
Map4k5 T A 12: 69,874,264 probably benign Het
Mast3 A G 8: 70,781,321 S178P probably damaging Het
Mau2 A G 8: 70,023,612 probably null Het
Mkrn2 A T 6: 115,614,651 N312Y probably damaging Het
Mrvi1 T C 7: 110,876,900 S615G probably benign Het
Myh1 A G 11: 67,202,533 E150G probably damaging Het
Myo7b T A 18: 31,961,825 probably null Het
Nyap1 A G 5: 137,735,298 V491A probably damaging Het
Olfr1284 A G 2: 111,379,293 M98V probably damaging Het
Olfr484 T C 7: 108,124,734 I176M probably benign Het
Olfr518 A T 7: 108,881,533 N24K probably damaging Het
Olfr954 T C 9: 39,461,532 F34L probably damaging Het
Oxsm A T 14: 16,240,893 H385Q probably damaging Het
Pbld2 T C 10: 63,056,811 S242P probably damaging Het
Pdzd7 T C 19: 45,029,305 Y675C probably damaging Het
Pnkd T A 1: 74,351,541 H266Q probably damaging Het
Rbfox2 A G 15: 77,099,279 S141P probably benign Het
Rdx A G 9: 52,068,218 T214A probably benign Het
Ripor2 A T 13: 24,680,644 E219V probably damaging Het
Rufy2 G A 10: 63,011,844 probably benign Het
Slf2 T A 19: 44,975,726 probably benign Het
Snrnp200 G T 2: 127,226,145 probably benign Het
Snx7 T A 3: 117,829,671 probably benign Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Tacr3 G A 3: 134,855,000 probably null Het
Tcerg1 C T 18: 42,571,840 T978M probably damaging Het
Tcf7l1 G T 6: 72,788,269 P126Q possibly damaging Het
Trank1 A G 9: 111,365,488 D860G probably damaging Het
Try4 T C 6: 41,304,367 L81P probably benign Het
Ucp1 T C 8: 83,297,847 probably benign Het
Ugt2b38 G A 5: 87,420,452 A328V probably damaging Het
Wfikkn1 T A 17: 25,878,017 R444S probably damaging Het
Zfc3h1 A G 10: 115,410,632 T875A probably benign Het
Zfp11 A G 5: 129,657,264 S378P probably damaging Het
Zfp984 T A 4: 147,756,232 N54I probably damaging Het
Other mutations in Kif23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Kif23 APN 9 61926468 missense probably benign 0.19
IGL00814:Kif23 APN 9 61937107 missense possibly damaging 0.95
IGL01295:Kif23 APN 9 61932129 missense possibly damaging 0.89
IGL01521:Kif23 APN 9 61919900 missense probably damaging 0.99
IGL01583:Kif23 APN 9 61935468 missense probably damaging 1.00
IGL01680:Kif23 APN 9 61931814 missense probably benign 0.17
IGL02450:Kif23 APN 9 61923957 missense probably benign 0.00
IGL02698:Kif23 APN 9 61925001 missense possibly damaging 0.49
IGL03152:Kif23 APN 9 61929776 splice site probably benign
IGL03233:Kif23 APN 9 61926453 missense probably benign 0.05
H8562:Kif23 UTSW 9 61924065 missense probably benign
R0225:Kif23 UTSW 9 61925694 splice site probably benign
R0419:Kif23 UTSW 9 61926405 nonsense probably null
R0512:Kif23 UTSW 9 61918975 splice site probably benign
R0980:Kif23 UTSW 9 61936764 missense possibly damaging 0.93
R1315:Kif23 UTSW 9 61923988 unclassified probably null
R1347:Kif23 UTSW 9 61927156 missense probably damaging 0.99
R1347:Kif23 UTSW 9 61927156 missense probably damaging 0.99
R1451:Kif23 UTSW 9 61924802 missense probably damaging 1.00
R1624:Kif23 UTSW 9 61925700 splice site probably null
R1820:Kif23 UTSW 9 61926438 missense possibly damaging 0.67
R1867:Kif23 UTSW 9 61918961 missense possibly damaging 0.87
R1937:Kif23 UTSW 9 61946610 critical splice donor site probably null
R2001:Kif23 UTSW 9 61927384 nonsense probably null
R2002:Kif23 UTSW 9 61927384 nonsense probably null
R2310:Kif23 UTSW 9 61924144 missense probably damaging 1.00
R2680:Kif23 UTSW 9 61937476 missense probably benign 0.25
R3196:Kif23 UTSW 9 61931911 nonsense probably null
R3774:Kif23 UTSW 9 61924992 missense probably benign 0.00
R3775:Kif23 UTSW 9 61924992 missense probably benign 0.00
R3776:Kif23 UTSW 9 61924992 missense probably benign 0.00
R4349:Kif23 UTSW 9 61932114 missense probably damaging 1.00
R4671:Kif23 UTSW 9 61945359 missense probably benign 0.04
R4981:Kif23 UTSW 9 61931871 missense probably damaging 1.00
R4983:Kif23 UTSW 9 61936703 missense probably benign 0.01
R5685:Kif23 UTSW 9 61945409 missense probably benign 0.12
R5721:Kif23 UTSW 9 61944216 missense probably benign 0.45
R6903:Kif23 UTSW 9 61927154 missense possibly damaging 0.77
R7067:Kif23 UTSW 9 61924989 missense probably benign 0.01
R7103:Kif23 UTSW 9 61919892 missense probably damaging 0.99
R7456:Kif23 UTSW 9 61937120 missense probably benign 0.09
R7468:Kif23 UTSW 9 61937175 nonsense probably null
Z1177:Kif23 UTSW 9 61924163 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GACGCTCCTACAGAGAGCAATGAC -3'
(R):5'- TGCAGGTGAGTGTGTCCACAAG -3'

Sequencing Primer
(F):5'- GCAATGACAACTCAGTCTACTTTAG -3'
(R):5'- AAGGGCTATTTCTTCTACAGTTAGG -3'
Posted On2013-09-03