Incidental Mutation 'R0731:Dock3'
ID 67569
Institutional Source Beutler Lab
Gene Symbol Dock3
Ensembl Gene ENSMUSG00000039716
Gene Name dedicator of cyto-kinesis 3
Synonyms Moca, PBP
MMRRC Submission 038912-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.616) question?
Stock # R0731 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 106770024-107109108 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106847055 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 858 (V858E)
Ref Sequence ENSEMBL: ENSMUSP00000047652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044532]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000044532
AA Change: V858E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047652
Gene: ENSMUSG00000039716
AA Change: V858E

DomainStartEndE-ValueType
SH3 9 66 3.85e-9 SMART
Pfam:DOCK_N 69 412 1.4e-120 PFAM
Pfam:DOCK-C2 417 608 7.7e-56 PFAM
low complexity region 854 867 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
Pfam:DHR-2 1121 1628 9e-133 PFAM
low complexity region 1679 1690 N/A INTRINSIC
low complexity region 1693 1704 N/A INTRINSIC
low complexity region 1730 1754 N/A INTRINSIC
low complexity region 1880 1902 N/A INTRINSIC
low complexity region 1963 1977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165075
SMART Domains Protein: ENSMUSP00000130873
Gene: ENSMUSG00000039716

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Meta Mutation Damage Score 0.7623 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the central nervous system (CNS). It encodes a member of the DOCK (dedicator of cytokinesis) family of guanine nucleotide exchange factors (GEFs). This protein, dedicator of cytokinesis 3 (DOCK3), is also known as modifier of cell adhesion (MOCA) and presenilin-binding protein (PBP). The DOCK3 and DOCK1, -2 and -4 share several conserved amino acids in their DHR-2 (DOCK homology region 2) domains that are required for GEF activity, and bind directly to WAVE proteins [Wiskott-Aldrich syndrome protein (WASP) family Verprolin-homologous proteins] via their DHR-1 domains. The DOCK3 induces axonal outgrowth in CNS by stimulating membrane recruitment of the WAVE complex and activating the small G protein Rac1. This gene is associated with an attention deficit hyperactivity disorder-like phenotype by a complex chromosomal rearrangement. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal behaviors and muscular weakness associated with axonal dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,367,247 (GRCm39) R27* probably null Het
Actg1 A G 11: 120,237,775 (GRCm39) F255S probably damaging Het
Ahdc1 T A 4: 132,790,262 (GRCm39) V501E possibly damaging Het
Alpk2 A T 18: 65,438,461 (GRCm39) D1444E probably damaging Het
Btaf1 T G 19: 36,974,895 (GRCm39) probably null Het
Cacnb2 A G 2: 14,990,517 (GRCm39) H489R possibly damaging Het
Ccdc162 C A 10: 41,455,139 (GRCm39) K398N probably damaging Het
Cd79b G T 11: 106,203,259 (GRCm39) S145R probably damaging Het
Cdh11 T A 8: 103,394,651 (GRCm39) N264Y probably damaging Het
Celsr1 T C 15: 85,785,798 (GRCm39) D2892G probably benign Het
Chuk A G 19: 44,092,205 (GRCm39) probably benign Het
Clk3 T C 9: 57,658,409 (GRCm39) probably benign Het
Dcaf8 A T 1: 172,000,076 (GRCm39) D78V possibly damaging Het
Dctn1 A G 6: 83,160,071 (GRCm39) T87A probably damaging Het
Ddx50 T C 10: 62,452,028 (GRCm39) N732D unknown Het
Dnah5 A T 15: 28,311,289 (GRCm39) Y1756F possibly damaging Het
Fer1l4 A G 2: 155,865,990 (GRCm39) F1566S probably benign Het
Fpr-rs7 T C 17: 20,334,116 (GRCm39) I125V probably benign Het
Fuca2 C T 10: 13,381,771 (GRCm39) P228L probably benign Het
Galntl6 A G 8: 58,989,018 (GRCm39) F57L probably benign Het
Gigyf2 T A 1: 87,335,449 (GRCm39) probably benign Het
Gm16505 A T 13: 3,411,329 (GRCm39) noncoding transcript Het
Gm4781 T C 10: 100,232,639 (GRCm39) noncoding transcript Het
Gm9956 T A 10: 56,621,639 (GRCm39) Y100* probably null Het
Gpr137c T A 14: 45,483,806 (GRCm39) C178S probably damaging Het
Gpr83 A G 9: 14,779,940 (GRCm39) R331G probably benign Het
Hlcs T A 16: 93,932,711 (GRCm39) H851L probably damaging Het
Irag1 T C 7: 110,476,107 (GRCm39) S615G probably benign Het
Kbtbd6 C A 14: 79,689,324 (GRCm39) Y6* probably null Het
Kif23 T C 9: 61,832,314 (GRCm39) R610G possibly damaging Het
Kifc3 G A 8: 95,832,361 (GRCm39) T487I probably damaging Het
Klra5 A C 6: 129,885,759 (GRCm39) D133E possibly damaging Het
Klra6 T C 6: 129,999,668 (GRCm39) E100G probably damaging Het
Klre1 T A 6: 129,562,531 (GRCm39) probably benign Het
Lancl1 C T 1: 67,049,069 (GRCm39) probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Man1b1 A G 2: 25,228,167 (GRCm39) I146V possibly damaging Het
Map4k5 T A 12: 69,921,038 (GRCm39) probably benign Het
Mast3 A G 8: 71,233,965 (GRCm39) S178P probably damaging Het
Mau2 A G 8: 70,476,262 (GRCm39) probably null Het
Mgat4f A C 1: 134,317,713 (GRCm39) M162L probably benign Het
Mkrn2 A T 6: 115,591,612 (GRCm39) N312Y probably damaging Het
Myh1 A G 11: 67,093,359 (GRCm39) E150G probably damaging Het
Myo7b T A 18: 32,094,878 (GRCm39) probably null Het
Nyap1 A G 5: 137,733,560 (GRCm39) V491A probably damaging Het
Or10a3 A T 7: 108,480,740 (GRCm39) N24K probably damaging Het
Or4g17 A G 2: 111,209,638 (GRCm39) M98V probably damaging Het
Or5p60 T C 7: 107,723,941 (GRCm39) I176M probably benign Het
Or8g34 T C 9: 39,372,828 (GRCm39) F34L probably damaging Het
Oxsm A T 14: 16,240,893 (GRCm38) H385Q probably damaging Het
Pbld2 T C 10: 62,892,590 (GRCm39) S242P probably damaging Het
Pdzd7 T C 19: 45,017,744 (GRCm39) Y675C probably damaging Het
Pnkd T A 1: 74,390,700 (GRCm39) H266Q probably damaging Het
Rbfox2 A G 15: 76,983,479 (GRCm39) S141P probably benign Het
Rdx A G 9: 51,979,518 (GRCm39) T214A probably benign Het
Ripor2 A T 13: 24,864,627 (GRCm39) E219V probably damaging Het
Rlig1 T C 10: 100,422,065 (GRCm39) T66A probably damaging Het
Rufy2 G A 10: 62,847,623 (GRCm39) probably benign Het
Slf2 T A 19: 44,964,165 (GRCm39) probably benign Het
Snrnp200 G T 2: 127,068,065 (GRCm39) probably benign Het
Snx7 T A 3: 117,623,320 (GRCm39) probably benign Het
Stt3a T C 9: 36,646,808 (GRCm39) I602V probably damaging Het
Tacr3 G A 3: 134,560,761 (GRCm39) probably null Het
Tcerg1 C T 18: 42,704,905 (GRCm39) T978M probably damaging Het
Tcf7l1 G T 6: 72,765,252 (GRCm39) P126Q possibly damaging Het
Trank1 A G 9: 111,194,556 (GRCm39) D860G probably damaging Het
Try4 T C 6: 41,281,301 (GRCm39) L81P probably benign Het
Ucp1 T C 8: 84,024,476 (GRCm39) probably benign Het
Ugt2b38 G A 5: 87,568,311 (GRCm39) A328V probably damaging Het
Wfikkn1 T A 17: 26,096,991 (GRCm39) R444S probably damaging Het
Zfc3h1 A G 10: 115,246,537 (GRCm39) T875A probably benign Het
Zfp11 A G 5: 129,734,328 (GRCm39) S378P probably damaging Het
Zfp984 T A 4: 147,840,689 (GRCm39) N54I probably damaging Het
Other mutations in Dock3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Dock3 APN 9 106,788,576 (GRCm39) splice site probably benign
IGL01067:Dock3 APN 9 106,959,572 (GRCm39) critical splice donor site probably null
IGL01160:Dock3 APN 9 106,783,887 (GRCm39) missense probably damaging 1.00
IGL01290:Dock3 APN 9 106,835,599 (GRCm39) splice site probably benign
IGL01291:Dock3 APN 9 106,835,599 (GRCm39) splice site probably benign
IGL01391:Dock3 APN 9 106,784,433 (GRCm39) missense possibly damaging 0.55
IGL01399:Dock3 APN 9 106,870,670 (GRCm39) missense probably benign 0.06
IGL01660:Dock3 APN 9 106,909,563 (GRCm39) splice site probably benign
IGL01752:Dock3 APN 9 106,902,512 (GRCm39) splice site probably benign
IGL01820:Dock3 APN 9 106,773,092 (GRCm39) missense probably damaging 1.00
IGL01908:Dock3 APN 9 106,783,861 (GRCm39) missense possibly damaging 0.81
IGL02191:Dock3 APN 9 106,815,340 (GRCm39) missense probably benign
IGL02227:Dock3 APN 9 106,939,254 (GRCm39) missense probably damaging 0.98
IGL02309:Dock3 APN 9 106,790,351 (GRCm39) missense probably damaging 1.00
IGL02408:Dock3 APN 9 106,790,298 (GRCm39) splice site probably benign
IGL02469:Dock3 APN 9 106,863,215 (GRCm39) missense probably damaging 0.98
IGL02545:Dock3 APN 9 106,939,271 (GRCm39) missense probably damaging 1.00
IGL02894:Dock3 APN 9 106,807,298 (GRCm39) missense probably benign 0.00
IGL02934:Dock3 APN 9 106,900,944 (GRCm39) missense probably benign 0.01
IGL03027:Dock3 APN 9 106,870,677 (GRCm39) missense probably damaging 0.98
IGL03068:Dock3 APN 9 106,841,958 (GRCm39) missense possibly damaging 0.82
IGL03128:Dock3 APN 9 106,909,491 (GRCm39) missense probably benign 0.05
IGL03161:Dock3 APN 9 106,900,987 (GRCm39) missense probably damaging 0.99
IGL03263:Dock3 APN 9 106,807,330 (GRCm39) splice site probably benign
IGL03279:Dock3 APN 9 106,788,447 (GRCm39) splice site probably benign
IGL03366:Dock3 APN 9 106,882,632 (GRCm39) missense probably benign 0.01
Implosion UTSW 9 106,815,125 (GRCm39) missense probably benign 0.00
Squeeze UTSW 9 106,807,242 (GRCm39) missense probably damaging 1.00
Tight UTSW 9 106,872,080 (GRCm39) missense probably damaging 1.00
ANU05:Dock3 UTSW 9 106,772,862 (GRCm39) missense probably benign
R0025:Dock3 UTSW 9 106,790,467 (GRCm39) missense possibly damaging 0.90
R0025:Dock3 UTSW 9 106,790,467 (GRCm39) missense possibly damaging 0.90
R0030:Dock3 UTSW 9 106,789,512 (GRCm39) missense possibly damaging 0.64
R0076:Dock3 UTSW 9 106,788,685 (GRCm39) splice site probably benign
R0076:Dock3 UTSW 9 106,788,685 (GRCm39) splice site probably benign
R0206:Dock3 UTSW 9 106,874,195 (GRCm39) nonsense probably null
R0208:Dock3 UTSW 9 106,874,195 (GRCm39) nonsense probably null
R0384:Dock3 UTSW 9 106,779,094 (GRCm39) splice site probably benign
R0610:Dock3 UTSW 9 106,900,987 (GRCm39) missense probably damaging 0.99
R1184:Dock3 UTSW 9 106,846,999 (GRCm39) missense probably damaging 1.00
R1350:Dock3 UTSW 9 106,791,831 (GRCm39) missense possibly damaging 0.52
R1393:Dock3 UTSW 9 106,788,548 (GRCm39) missense probably damaging 1.00
R1424:Dock3 UTSW 9 106,790,392 (GRCm39) missense probably damaging 1.00
R1469:Dock3 UTSW 9 106,832,908 (GRCm39) missense probably benign 0.37
R1469:Dock3 UTSW 9 106,832,908 (GRCm39) missense probably benign 0.37
R1539:Dock3 UTSW 9 106,874,112 (GRCm39) missense probably benign 0.23
R1539:Dock3 UTSW 9 106,829,563 (GRCm39) missense probably damaging 1.00
R1571:Dock3 UTSW 9 106,815,158 (GRCm39) missense possibly damaging 0.92
R1682:Dock3 UTSW 9 106,851,040 (GRCm39) missense probably damaging 0.98
R1795:Dock3 UTSW 9 106,902,534 (GRCm39) missense probably damaging 0.99
R1987:Dock3 UTSW 9 106,985,620 (GRCm39) missense probably benign 0.01
R2000:Dock3 UTSW 9 106,870,160 (GRCm39) splice site probably benign
R2074:Dock3 UTSW 9 106,870,662 (GRCm39) missense possibly damaging 0.46
R2114:Dock3 UTSW 9 106,870,743 (GRCm39) missense probably benign 0.00
R2265:Dock3 UTSW 9 106,818,525 (GRCm39) missense probably damaging 1.00
R2269:Dock3 UTSW 9 106,818,525 (GRCm39) missense probably damaging 1.00
R2370:Dock3 UTSW 9 106,829,554 (GRCm39) missense probably damaging 1.00
R2377:Dock3 UTSW 9 106,773,090 (GRCm39) missense probably damaging 0.98
R2385:Dock3 UTSW 9 106,868,324 (GRCm39) missense probably damaging 1.00
R2426:Dock3 UTSW 9 106,791,740 (GRCm39) missense possibly damaging 0.76
R3076:Dock3 UTSW 9 106,818,725 (GRCm39) critical splice acceptor site probably null
R3122:Dock3 UTSW 9 106,788,542 (GRCm39) missense probably damaging 0.99
R4052:Dock3 UTSW 9 106,850,995 (GRCm39) missense probably damaging 0.99
R4294:Dock3 UTSW 9 106,807,242 (GRCm39) missense probably damaging 1.00
R4623:Dock3 UTSW 9 106,939,244 (GRCm39) missense possibly damaging 0.61
R4664:Dock3 UTSW 9 106,870,743 (GRCm39) missense possibly damaging 0.71
R4705:Dock3 UTSW 9 106,902,535 (GRCm39) missense probably damaging 1.00
R4771:Dock3 UTSW 9 106,829,557 (GRCm39) missense possibly damaging 0.89
R4898:Dock3 UTSW 9 106,870,171 (GRCm39) missense possibly damaging 0.75
R4898:Dock3 UTSW 9 106,807,266 (GRCm39) missense probably damaging 1.00
R4948:Dock3 UTSW 9 106,868,354 (GRCm39) missense probably damaging 0.96
R4961:Dock3 UTSW 9 106,818,515 (GRCm39) missense probably damaging 1.00
R4986:Dock3 UTSW 9 106,809,182 (GRCm39) missense probably damaging 1.00
R5054:Dock3 UTSW 9 106,815,105 (GRCm39) missense probably damaging 1.00
R5065:Dock3 UTSW 9 106,832,883 (GRCm39) missense probably damaging 1.00
R5081:Dock3 UTSW 9 106,868,292 (GRCm39) missense probably damaging 1.00
R5101:Dock3 UTSW 9 106,846,980 (GRCm39) missense probably damaging 1.00
R5135:Dock3 UTSW 9 106,810,196 (GRCm39) missense probably damaging 1.00
R5227:Dock3 UTSW 9 106,863,269 (GRCm39) missense probably damaging 1.00
R5257:Dock3 UTSW 9 106,874,124 (GRCm39) missense probably damaging 1.00
R5258:Dock3 UTSW 9 106,874,124 (GRCm39) missense probably damaging 1.00
R5273:Dock3 UTSW 9 106,777,904 (GRCm39) critical splice donor site probably null
R5322:Dock3 UTSW 9 106,779,028 (GRCm39) missense probably benign 0.14
R5482:Dock3 UTSW 9 106,855,937 (GRCm39) nonsense probably null
R5553:Dock3 UTSW 9 106,868,309 (GRCm39) missense possibly damaging 0.81
R5631:Dock3 UTSW 9 106,832,898 (GRCm39) missense probably benign 0.01
R5739:Dock3 UTSW 9 106,850,995 (GRCm39) missense possibly damaging 0.92
R5838:Dock3 UTSW 9 106,772,687 (GRCm39) missense possibly damaging 0.51
R5888:Dock3 UTSW 9 106,901,002 (GRCm39) missense probably benign 0.12
R5960:Dock3 UTSW 9 106,788,554 (GRCm39) nonsense probably null
R5974:Dock3 UTSW 9 106,871,261 (GRCm39) missense probably damaging 1.00
R6116:Dock3 UTSW 9 106,809,161 (GRCm39) missense probably damaging 1.00
R6162:Dock3 UTSW 9 106,841,998 (GRCm39) missense possibly damaging 0.88
R6176:Dock3 UTSW 9 106,790,147 (GRCm39) missense probably benign 0.05
R6219:Dock3 UTSW 9 106,872,080 (GRCm39) missense probably damaging 1.00
R6238:Dock3 UTSW 9 106,790,147 (GRCm39) missense probably benign 0.05
R6266:Dock3 UTSW 9 106,841,952 (GRCm39) missense probably damaging 0.99
R6291:Dock3 UTSW 9 106,785,631 (GRCm39) missense probably benign
R6531:Dock3 UTSW 9 106,844,415 (GRCm39) missense probably benign
R6567:Dock3 UTSW 9 106,773,946 (GRCm39) missense probably benign 0.13
R6572:Dock3 UTSW 9 106,866,674 (GRCm39) missense probably damaging 0.99
R6620:Dock3 UTSW 9 106,815,125 (GRCm39) missense probably benign 0.00
R6726:Dock3 UTSW 9 107,036,651 (GRCm39) nonsense probably null
R7085:Dock3 UTSW 9 106,779,086 (GRCm39) missense probably damaging 1.00
R7151:Dock3 UTSW 9 106,841,916 (GRCm39) missense possibly damaging 0.68
R7320:Dock3 UTSW 9 106,772,723 (GRCm39) missense probably benign 0.20
R7357:Dock3 UTSW 9 106,882,568 (GRCm39) missense probably benign 0.34
R7423:Dock3 UTSW 9 106,844,370 (GRCm39) missense probably damaging 0.98
R7426:Dock3 UTSW 9 106,772,782 (GRCm39) missense probably benign
R7439:Dock3 UTSW 9 106,900,931 (GRCm39) missense probably damaging 1.00
R7452:Dock3 UTSW 9 106,866,664 (GRCm39) missense probably damaging 1.00
R7470:Dock3 UTSW 9 106,882,644 (GRCm39) missense probably damaging 1.00
R7879:Dock3 UTSW 9 106,785,700 (GRCm39) missense probably benign 0.05
R8047:Dock3 UTSW 9 106,870,208 (GRCm39) missense possibly damaging 0.93
R8308:Dock3 UTSW 9 106,790,371 (GRCm39) missense probably benign 0.00
R8837:Dock3 UTSW 9 106,774,539 (GRCm39) missense probably benign
R8862:Dock3 UTSW 9 106,855,927 (GRCm39) missense probably damaging 1.00
R8952:Dock3 UTSW 9 106,850,958 (GRCm39) missense probably benign 0.03
R9230:Dock3 UTSW 9 106,807,223 (GRCm39) missense probably damaging 1.00
R9269:Dock3 UTSW 9 106,818,522 (GRCm39) missense probably benign 0.01
R9272:Dock3 UTSW 9 106,774,569 (GRCm39) missense probably benign 0.00
R9344:Dock3 UTSW 9 106,870,763 (GRCm39) missense probably damaging 1.00
R9757:Dock3 UTSW 9 106,901,035 (GRCm39) missense possibly damaging 0.48
R9764:Dock3 UTSW 9 106,959,713 (GRCm39) missense probably benign 0.00
R9766:Dock3 UTSW 9 106,788,483 (GRCm39) missense probably benign 0.01
X0023:Dock3 UTSW 9 106,863,197 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CATACACGTTCATTTGGGCACTTGC -3'
(R):5'- AGTGACAGGCTTCAAAGACATGGC -3'

Sequencing Primer
(F):5'- CATCAATAAAGGCATCTGACTGAG -3'
(R):5'- GCTCATGGTAAATGTGACACAC -3'
Posted On 2013-09-03