Incidental Mutation 'R8862:Ror1'
ID675699
Institutional Source Beutler Lab
Gene Symbol Ror1
Ensembl Gene ENSMUSG00000035305
Gene Namereceptor tyrosine kinase-like orphan receptor 1
Synonyms2810404D04Rik, Ntrkr1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8862 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location100095791-100444765 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 100334518 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039630]
Predicted Effect probably null
Transcript: ENSMUST00000039630
SMART Domains Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 70 138 8.37e-15 SMART
Pfam:Fz 170 290 4.9e-13 PFAM
KR 311 393 7.57e-47 SMART
transmembrane domain 404 426 N/A INTRINSIC
TyrKc 473 746 2.46e-137 SMART
low complexity region 753 762 N/A INTRINSIC
low complexity region 817 828 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T C 6: 129,331,531 T12A probably benign Het
Acin1 C T 14: 54,663,715 G685R probably benign Het
Ahdc1 T C 4: 133,063,818 F790S possibly damaging Het
Alg10b T C 15: 90,225,690 Y69H probably damaging Het
Amer3 A T 1: 34,587,384 S235C probably damaging Het
Ankfy1 G T 11: 72,753,643 S722I probably benign Het
Baz1a T C 12: 54,985,839 probably benign Het
Ccdc177 A G 12: 80,757,434 S689P unknown Het
Cdh24 C A 14: 54,632,417 R681L probably damaging Het
Cdk14 T G 5: 5,010,862 I338L probably benign Het
Col18a1 G T 10: 77,113,210 S156* probably null Het
Col6a6 T C 9: 105,786,149 Y63C probably damaging Het
Cytip G A 2: 58,147,875 T159M probably benign Het
D10Jhu81e A G 10: 78,169,627 S35P probably damaging Het
Dock3 T C 9: 106,978,728 Y744C probably damaging Het
Dopey1 T C 9: 86,524,351 probably null Het
Dse A T 10: 34,153,938 D385E probably damaging Het
Efhc1 A C 1: 20,967,349 D250A Het
Epha3 T A 16: 63,610,985 T519S probably benign Het
Gas2l3 A G 10: 89,414,420 Y279H probably damaging Het
Gemin6 G A 17: 80,228,003 V131I probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm4869 C A 5: 140,486,779 P686Q probably damaging Het
Gnai2 C A 9: 107,635,127 A31S Het
Greb1l A G 18: 10,555,042 D1696G possibly damaging Het
Itfg2 T C 6: 128,417,705 E35G probably damaging Het
Kctd10 A G 5: 114,365,860 F244L probably damaging Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Lrriq4 A T 3: 30,650,939 N372I probably damaging Het
Mical2 A G 7: 112,311,367 N248S probably damaging Het
Mipep T A 14: 60,843,240 C560* probably null Het
Myo1a G A 10: 127,712,784 V396M probably benign Het
Myod1 A G 7: 46,377,063 T131A probably damaging Het
Nalcn T A 14: 123,409,787 D558V possibly damaging Het
Olfr213 G A 6: 116,541,225 M257I probably benign Het
Plbd2 A T 5: 120,486,663 M480K probably damaging Het
Ppargc1a A G 5: 51,473,893 F465L possibly damaging Het
Ppp1r15b A T 1: 133,136,768 I659F probably damaging Het
Prune2 C T 19: 17,120,146 L1005F probably benign Het
Pter T C 2: 12,980,530 S224P probably damaging Het
Ralgapa2 A G 2: 146,424,811 I615T probably benign Het
Rps2 A G 17: 24,721,688 T259A probably benign Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
S1pr4 G A 10: 81,498,699 R314C probably damaging Het
Sema4f A T 6: 82,914,100 H575Q probably benign Het
Son A G 16: 91,656,846 D827G probably damaging Het
Sox8 A T 17: 25,568,071 H219Q possibly damaging Het
Spink2 C T 5: 77,209,768 D24N probably benign Het
Stard9 A G 2: 120,703,618 D3452G probably benign Het
Syngr2 G T 11: 117,812,681 D108Y probably damaging Het
Tardbp G A 4: 148,618,298 S403L possibly damaging Het
Tomm70a T C 16: 57,122,183 S108P probably benign Het
Ttc12 T C 9: 49,440,215 T661A probably benign Het
Tubgcp6 A G 15: 89,122,621 V66A probably benign Het
Unc13b T A 4: 43,235,207 L477Q probably damaging Het
Vmn1r77 T A 7: 12,042,133 C279S probably benign Het
Vmn2r79 T C 7: 86,996,504 S14P probably benign Het
Zan T C 5: 137,474,412 T72A probably benign Het
Zcchc2 A G 1: 106,031,268 *1156W probably null Het
Zfp354c A T 11: 50,817,891 D26E probably benign Het
Other mutations in Ror1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Ror1 APN 4 100333743 missense probably damaging 1.00
IGL00939:Ror1 APN 4 100441226 missense probably benign 0.01
IGL01408:Ror1 APN 4 100333787 missense probably damaging 1.00
IGL01678:Ror1 APN 4 100425968 missense possibly damaging 0.68
IGL01700:Ror1 APN 4 100409771 missense probably damaging 1.00
IGL01985:Ror1 APN 4 100425964 missense possibly damaging 0.94
IGL02002:Ror1 APN 4 100441184 missense probably damaging 1.00
IGL02634:Ror1 APN 4 100426110 missense probably benign 0.00
IGL02995:Ror1 APN 4 100334525 splice site probably benign
IGL03033:Ror1 APN 4 100411895 missense possibly damaging 0.67
IGL03207:Ror1 APN 4 100407945 splice site probably null
F5770:Ror1 UTSW 4 100440933 missense probably damaging 0.99
R0256:Ror1 UTSW 4 100409745 missense probably benign 0.20
R0417:Ror1 UTSW 4 100412000 missense possibly damaging 0.94
R0525:Ror1 UTSW 4 100441520 missense probably damaging 1.00
R1034:Ror1 UTSW 4 100333620 nonsense probably null
R1278:Ror1 UTSW 4 100441878 missense possibly damaging 0.69
R1368:Ror1 UTSW 4 100441137 missense possibly damaging 0.94
R1437:Ror1 UTSW 4 100412109 missense probably benign
R1441:Ror1 UTSW 4 100440983 missense probably benign
R1544:Ror1 UTSW 4 100441986 missense probably damaging 1.00
R1717:Ror1 UTSW 4 100302938 missense probably benign
R1857:Ror1 UTSW 4 100441503 missense probably damaging 1.00
R2018:Ror1 UTSW 4 100407841 nonsense probably null
R2051:Ror1 UTSW 4 100407868 nonsense probably null
R2127:Ror1 UTSW 4 100442093 missense probably benign
R2132:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2133:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2176:Ror1 UTSW 4 100441874 missense probably damaging 0.99
R2431:Ror1 UTSW 4 100441155 missense probably damaging 1.00
R2896:Ror1 UTSW 4 100096280 missense unknown
R3005:Ror1 UTSW 4 100441764 missense probably damaging 0.99
R3780:Ror1 UTSW 4 100412117 missense probably benign 0.34
R3850:Ror1 UTSW 4 100442160 missense possibly damaging 0.90
R3861:Ror1 UTSW 4 100407923 missense possibly damaging 0.46
R4599:Ror1 UTSW 4 100407910 missense probably damaging 0.99
R4863:Ror1 UTSW 4 100409804 missense probably damaging 0.99
R4871:Ror1 UTSW 4 100425998 missense probably benign
R4990:Ror1 UTSW 4 100441964 missense probably benign
R5023:Ror1 UTSW 4 100425932 missense probably benign 0.01
R5028:Ror1 UTSW 4 100411936 missense possibly damaging 0.67
R5079:Ror1 UTSW 4 100441422 missense probably damaging 1.00
R5294:Ror1 UTSW 4 100425938 missense probably benign 0.00
R5538:Ror1 UTSW 4 100441011 missense probably benign
R6339:Ror1 UTSW 4 100411931 missense possibly damaging 0.91
R6491:Ror1 UTSW 4 100409912 missense possibly damaging 0.94
R6632:Ror1 UTSW 4 100442106 missense probably benign
R6733:Ror1 UTSW 4 100426055 missense probably benign
R7022:Ror1 UTSW 4 100407911 missense probably damaging 1.00
R7054:Ror1 UTSW 4 100442239 missense probably benign 0.00
R7121:Ror1 UTSW 4 100302945 missense probably benign 0.00
R7350:Ror1 UTSW 4 100425943 missense probably benign 0.00
R7492:Ror1 UTSW 4 100441059 missense probably benign 0.22
R7502:Ror1 UTSW 4 100333630 missense probably benign 0.03
R7531:Ror1 UTSW 4 100441191 missense probably damaging 1.00
R7661:Ror1 UTSW 4 100441490 missense probably damaging 1.00
R7822:Ror1 UTSW 4 100441367 missense probably damaging 1.00
R7831:Ror1 UTSW 4 100441098 missense probably benign 0.01
R8366:Ror1 UTSW 4 100409998 missense possibly damaging 0.91
R8539:Ror1 UTSW 4 100441887 missense possibly damaging 0.71
R8757:Ror1 UTSW 4 100440883 missense probably benign 0.01
R8913:Ror1 UTSW 4 100407830 missense possibly damaging 0.89
V7580:Ror1 UTSW 4 100440933 missense probably damaging 0.99
V7583:Ror1 UTSW 4 100440933 missense probably damaging 0.99
X0020:Ror1 UTSW 4 100426090 missense probably benign 0.02
Z1177:Ror1 UTSW 4 100302919 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGATGGGCATGTTCTCACTGG -3'
(R):5'- GCTTTGATCAGTCAGATTCCTG -3'

Sequencing Primer
(F):5'- CACTGGTATTCTTTGATTCACAGAGG -3'
(R):5'- TCGCCAGGCTGGAGATGAC -3'
Posted On2021-07-15