Incidental Mutation 'R8862:Gemin6'
ID675747
Institutional Source Beutler Lab
Gene Symbol Gemin6
Ensembl Gene ENSMUSG00000055760
Gene Namegem nuclear organelle associated protein 6
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R8862 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location80224441-80228497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80228003 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 131 (V131I)
Ref Sequence ENSEMBL: ENSMUSP00000063554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069486]
Predicted Effect probably damaging
Transcript: ENSMUST00000069486
AA Change: V131I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063554
Gene: ENSMUSG00000055760
AA Change: V131I

DomainStartEndE-ValueType
Pfam:Gemin6 1 166 9.7e-102 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T C 6: 129,331,531 T12A probably benign Het
Acin1 C T 14: 54,663,715 G685R probably benign Het
Ahdc1 T C 4: 133,063,818 F790S possibly damaging Het
Alg10b T C 15: 90,225,690 Y69H probably damaging Het
Amer3 A T 1: 34,587,384 S235C probably damaging Het
Ankfy1 G T 11: 72,753,643 S722I probably benign Het
Baz1a T C 12: 54,985,839 probably benign Het
Ccdc177 A G 12: 80,757,434 S689P unknown Het
Cdh24 C A 14: 54,632,417 R681L probably damaging Het
Cdk14 T G 5: 5,010,862 I338L probably benign Het
Col18a1 G T 10: 77,113,210 S156* probably null Het
Col6a6 T C 9: 105,786,149 Y63C probably damaging Het
Cytip G A 2: 58,147,875 T159M probably benign Het
D10Jhu81e A G 10: 78,169,627 S35P probably damaging Het
Dock3 T C 9: 106,978,728 Y744C probably damaging Het
Dopey1 T C 9: 86,524,351 probably null Het
Dse A T 10: 34,153,938 D385E probably damaging Het
Efhc1 A C 1: 20,967,349 D250A Het
Epha3 T A 16: 63,610,985 T519S probably benign Het
Gas2l3 A G 10: 89,414,420 Y279H probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm4869 C A 5: 140,486,779 P686Q probably damaging Het
Gnai2 C A 9: 107,635,127 A31S Het
Greb1l A G 18: 10,555,042 D1696G possibly damaging Het
Itfg2 T C 6: 128,417,705 E35G probably damaging Het
Kctd10 A G 5: 114,365,860 F244L probably damaging Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Lrriq4 A T 3: 30,650,939 N372I probably damaging Het
Mical2 A G 7: 112,311,367 N248S probably damaging Het
Mipep T A 14: 60,843,240 C560* probably null Het
Myo1a G A 10: 127,712,784 V396M probably benign Het
Myod1 A G 7: 46,377,063 T131A probably damaging Het
Nalcn T A 14: 123,409,787 D558V possibly damaging Het
Olfr213 G A 6: 116,541,225 M257I probably benign Het
Plbd2 A T 5: 120,486,663 M480K probably damaging Het
Ppargc1a A G 5: 51,473,893 F465L possibly damaging Het
Ppp1r15b A T 1: 133,136,768 I659F probably damaging Het
Prune2 C T 19: 17,120,146 L1005F probably benign Het
Pter T C 2: 12,980,530 S224P probably damaging Het
Ralgapa2 A G 2: 146,424,811 I615T probably benign Het
Ror1 T C 4: 100,334,518 probably null Het
Rps2 A G 17: 24,721,688 T259A probably benign Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
S1pr4 G A 10: 81,498,699 R314C probably damaging Het
Sema4f A T 6: 82,914,100 H575Q probably benign Het
Son A G 16: 91,656,846 D827G probably damaging Het
Sox8 A T 17: 25,568,071 H219Q possibly damaging Het
Spink2 C T 5: 77,209,768 D24N probably benign Het
Stard9 A G 2: 120,703,618 D3452G probably benign Het
Syngr2 G T 11: 117,812,681 D108Y probably damaging Het
Tardbp G A 4: 148,618,298 S403L possibly damaging Het
Tomm70a T C 16: 57,122,183 S108P probably benign Het
Ttc12 T C 9: 49,440,215 T661A probably benign Het
Tubgcp6 A G 15: 89,122,621 V66A probably benign Het
Unc13b T A 4: 43,235,207 L477Q probably damaging Het
Vmn1r77 T A 7: 12,042,133 C279S probably benign Het
Vmn2r79 T C 7: 86,996,504 S14P probably benign Het
Zan T C 5: 137,474,412 T72A probably benign Het
Zcchc2 A G 1: 106,031,268 *1156W probably null Het
Zfp354c A T 11: 50,817,891 D26E probably benign Het
Other mutations in Gemin6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Gemin6 APN 17 80227865 missense possibly damaging 0.56
IGL02129:Gemin6 APN 17 80227926 missense probably damaging 1.00
R0197:Gemin6 UTSW 17 80228095 missense probably damaging 1.00
R0239:Gemin6 UTSW 17 80225710 missense probably damaging 1.00
R0239:Gemin6 UTSW 17 80225710 missense probably damaging 1.00
R0883:Gemin6 UTSW 17 80228095 missense probably damaging 1.00
R1995:Gemin6 UTSW 17 80227985 missense probably damaging 1.00
R4570:Gemin6 UTSW 17 80228069 nonsense probably null
R4885:Gemin6 UTSW 17 80227898 missense probably damaging 0.99
R5335:Gemin6 UTSW 17 80225755 missense probably damaging 1.00
R5445:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R5447:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R5451:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R5452:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R5522:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R5525:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R5526:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R7291:Gemin6 UTSW 17 80227775 missense possibly damaging 0.61
R7576:Gemin6 UTSW 17 80225726 nonsense probably null
R7845:Gemin6 UTSW 17 80225661 missense probably benign 0.00
R8842:Gemin6 UTSW 17 80225686 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCTGTGCAGACTGTGGAAAC -3'
(R):5'- AACCCTCATGTGCTTCTGATG -3'

Sequencing Primer
(F):5'- CTGTGCAGACTGTGGAAACCATAAG -3'
(R):5'- CTCATGTGCTTCTGATGTCTTG -3'
Posted On2021-07-15