Incidental Mutation 'R8863:Ttf1'
ID 675752
Institutional Source Beutler Lab
Gene Symbol Ttf1
Ensembl Gene ENSMUSG00000026803
Gene Name transcription termination factor, RNA polymerase I
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock # R8863 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 29060262-29087656 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 29079480 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100237] [ENSMUST00000100237]
AlphaFold Q62187
Predicted Effect probably null
Transcript: ENSMUST00000100237
SMART Domains Protein: ENSMUSP00000097809
Gene: ENSMUSG00000026803

DomainStartEndE-ValueType
internal_repeat_1 13 67 1.04e-14 PROSPERO
internal_repeat_1 85 142 1.04e-14 PROSPERO
low complexity region 143 153 N/A INTRINSIC
low complexity region 171 183 N/A INTRINSIC
low complexity region 274 293 N/A INTRINSIC
low complexity region 350 387 N/A INTRINSIC
low complexity region 434 447 N/A INTRINSIC
low complexity region 451 461 N/A INTRINSIC
Blast:SANT 508 585 8e-28 BLAST
SANT 589 636 2.37e-6 SMART
SANT 638 720 1.8e-6 SMART
low complexity region 805 819 N/A INTRINSIC
low complexity region 842 857 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100237
SMART Domains Protein: ENSMUSP00000097809
Gene: ENSMUSG00000026803

DomainStartEndE-ValueType
internal_repeat_1 13 67 1.04e-14 PROSPERO
internal_repeat_1 85 142 1.04e-14 PROSPERO
low complexity region 143 153 N/A INTRINSIC
low complexity region 171 183 N/A INTRINSIC
low complexity region 274 293 N/A INTRINSIC
low complexity region 350 387 N/A INTRINSIC
low complexity region 434 447 N/A INTRINSIC
low complexity region 451 461 N/A INTRINSIC
Blast:SANT 508 585 8e-28 BLAST
SANT 589 636 2.37e-6 SMART
SANT 638 720 1.8e-6 SMART
low complexity region 805 819 N/A INTRINSIC
low complexity region 842 857 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,108 L14P probably benign Het
9130023H24Rik A G 7: 128,236,951 S157P possibly damaging Het
9530053A07Rik A G 7: 28,131,581 D73G probably damaging Het
Aasdhppt C A 9: 4,309,424 A5S possibly damaging Het
Asb16 T C 11: 102,277,232 Y373H probably damaging Het
Axin1 T C 17: 26,143,401 S240P probably benign Het
C2cd5 T C 6: 143,041,362 I505V possibly damaging Het
Camk2g A G 14: 20,760,176 L305P probably damaging Het
Ccm2 A G 11: 6,585,211 K156E probably damaging Het
Cdh23 G T 10: 60,376,834 Y1600* probably null Het
Cyp2c29 A G 19: 39,273,366 Q16R probably benign Het
Ebf1 T A 11: 44,883,839 V221E probably damaging Het
Gtpbp1 A G 15: 79,707,061 E125G possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igfbp3 A G 11: 7,213,568 C75R probably damaging Het
Itgb4 T A 11: 115,985,072 C478* probably null Het
L3mbtl4 T A 17: 68,679,424 C488S probably benign Het
Lysmd4 T C 7: 67,223,745 S43P probably damaging Het
Mocs2 A G 13: 114,826,279 K167E probably damaging Het
Mpl C A 4: 118,457,405 V23F Het
Muc4 A T 16: 32,751,462 I447F possibly damaging Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Ncf2 A G 1: 152,836,113 *526W probably null Het
Oas1a C T 5: 120,905,880 G63D probably damaging Het
Olfr194 G T 16: 59,119,349 C240* probably null Het
Olfr450 A T 6: 42,817,846 Y125F probably damaging Het
Olfr895 T C 9: 38,269,359 V274A probably damaging Het
Piwil4 T C 9: 14,720,087 N409S probably benign Het
Pkhd1l1 C T 15: 44,569,986 Q3421* probably null Het
Plekha7 T A 7: 116,154,640 D664V probably damaging Het
Pole T C 5: 110,289,367 M66T possibly damaging Het
Pon2 C T 6: 5,265,480 probably null Het
Pop4 G A 7: 38,263,225 A205V possibly damaging Het
Ppp6r3 T A 19: 3,471,030 E590D probably damaging Het
Ptpn6 T A 6: 124,732,346 I96F probably damaging Het
Rfk T A 19: 17,395,226 N37K probably benign Het
Syne1 G T 10: 5,099,527 Q7535K probably damaging Het
Tcf15 A T 2: 152,144,103 I160F probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmem160 T C 7: 16,452,964 M1T probably null Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Trnt1 T C 6: 106,774,482 F140S probably damaging Het
Vmn1r172 A T 7: 23,659,785 I32F probably benign Het
Vwc2l T A 1: 70,728,904 N42K possibly damaging Het
Other mutations in Ttf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Ttf1 APN 2 29073883 splice site probably benign
IGL00916:Ttf1 APN 2 29070042 missense probably benign 0.05
IGL02148:Ttf1 APN 2 29079426 missense probably benign 0.17
IGL02631:Ttf1 APN 2 29069900 missense probably damaging 0.98
IGL02658:Ttf1 APN 2 29074011 missense probably damaging 1.00
IGL03057:Ttf1 APN 2 29071345 missense probably damaging 0.98
R0026:Ttf1 UTSW 2 29071349 missense possibly damaging 0.95
R0047:Ttf1 UTSW 2 29084655 missense probably damaging 1.00
R0047:Ttf1 UTSW 2 29084655 missense probably damaging 1.00
R0427:Ttf1 UTSW 2 29065042 missense probably benign 0.00
R0466:Ttf1 UTSW 2 29065407 missense possibly damaging 0.79
R0834:Ttf1 UTSW 2 29073950 nonsense probably null
R1548:Ttf1 UTSW 2 29065138 missense probably damaging 0.96
R1672:Ttf1 UTSW 2 29067152 missense probably damaging 0.98
R1696:Ttf1 UTSW 2 29070002 missense probably damaging 1.00
R1819:Ttf1 UTSW 2 29074784 missense possibly damaging 0.60
R2000:Ttf1 UTSW 2 29065185 missense possibly damaging 0.79
R2126:Ttf1 UTSW 2 29071345 missense probably damaging 0.98
R2426:Ttf1 UTSW 2 29067185 missense probably damaging 0.98
R2967:Ttf1 UTSW 2 29065383 missense possibly damaging 0.56
R3499:Ttf1 UTSW 2 29065487 missense possibly damaging 0.92
R3963:Ttf1 UTSW 2 29064804 missense possibly damaging 0.68
R4342:Ttf1 UTSW 2 29065476 missense probably benign 0.01
R4627:Ttf1 UTSW 2 29065160 missense possibly damaging 0.72
R4676:Ttf1 UTSW 2 29074594 missense probably damaging 0.96
R4907:Ttf1 UTSW 2 29064656 missense possibly damaging 0.72
R4909:Ttf1 UTSW 2 29064656 missense possibly damaging 0.72
R4926:Ttf1 UTSW 2 29064656 missense possibly damaging 0.72
R4927:Ttf1 UTSW 2 29064656 missense possibly damaging 0.72
R5746:Ttf1 UTSW 2 29065742 missense probably damaging 0.96
R5948:Ttf1 UTSW 2 29073920 missense possibly damaging 0.50
R6911:Ttf1 UTSW 2 29064851 missense probably benign 0.41
R7909:Ttf1 UTSW 2 29065459 missense probably benign 0.00
R8141:Ttf1 UTSW 2 29067226 nonsense probably null
R8264:Ttf1 UTSW 2 29064677 missense possibly damaging 0.91
R9094:Ttf1 UTSW 2 29067068 missense probably benign 0.15
R9281:Ttf1 UTSW 2 29065890 missense probably benign 0.01
R9318:Ttf1 UTSW 2 29074654 missense possibly damaging 0.47
R9440:Ttf1 UTSW 2 29065697 missense probably benign 0.41
R9483:Ttf1 UTSW 2 29079480 critical splice donor site probably null
X0066:Ttf1 UTSW 2 29074775 missense probably benign 0.05
Z1176:Ttf1 UTSW 2 29065812 missense probably damaging 1.00
Z1176:Ttf1 UTSW 2 29071337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGTGAATGAGAGCAATTTATG -3'
(R):5'- GGCGACAAGTAACTTCTCTTTC -3'

Sequencing Primer
(F):5'- TGCTGGTAACCTGAACTCAG -3'
(R):5'- CTCAGCCTCATTCAGAGTTGG -3'
Posted On 2021-07-15