Incidental Mutation 'R8863:Pole'
ID675755
Institutional Source Beutler Lab
Gene Symbol Pole
Ensembl Gene ENSMUSG00000007080
Gene Namepolymerase (DNA directed), epsilon
Synonymspol-epsilon
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8863 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location110286306-110337474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110289367 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 66 (M66T)
Ref Sequence ENSEMBL: ENSMUSP00000007296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296] [ENSMUST00000031472] [ENSMUST00000112482] [ENSMUST00000155266]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007296
AA Change: M66T

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: M66T

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000031472
SMART Domains Protein: ENSMUSP00000031472
Gene: ENSMUSG00000029499

DomainStartEndE-ValueType
low complexity region 17 35 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
Pfam:Mpv17_PMP22 128 192 2.7e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112482
AA Change: M66T

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108101
Gene: ENSMUSG00000007080
AA Change: M66T

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 86 190 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155266
SMART Domains Protein: ENSMUSP00000117729
Gene: ENSMUSG00000029499

DomainStartEndE-ValueType
low complexity region 17 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,108 L14P probably benign Het
9130023H24Rik A G 7: 128,236,951 S157P possibly damaging Het
9530053A07Rik A G 7: 28,131,581 D73G probably damaging Het
Aasdhppt C A 9: 4,309,424 A5S possibly damaging Het
Asb16 T C 11: 102,277,232 Y373H probably damaging Het
Axin1 T C 17: 26,143,401 S240P probably benign Het
C2cd5 T C 6: 143,041,362 I505V possibly damaging Het
Camk2g A G 14: 20,760,176 L305P probably damaging Het
Ccm2 A G 11: 6,585,211 K156E probably damaging Het
Cdh23 G T 10: 60,376,834 Y1600* probably null Het
Cyp2c29 A G 19: 39,273,366 Q16R probably benign Het
Ebf1 T A 11: 44,883,839 V221E probably damaging Het
Gtpbp1 A G 15: 79,707,061 E125G possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igfbp3 A G 11: 7,213,568 C75R probably damaging Het
Itgb4 T A 11: 115,985,072 C478* probably null Het
L3mbtl4 T A 17: 68,679,424 C488S probably benign Het
Lysmd4 T C 7: 67,223,745 S43P probably damaging Het
Mocs2 A G 13: 114,826,279 K167E probably damaging Het
Mpl C A 4: 118,457,405 V23F Het
Muc4 A T 16: 32,751,462 I447F possibly damaging Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Ncf2 A G 1: 152,836,113 *526W probably null Het
Oas1a C T 5: 120,905,880 G63D probably damaging Het
Olfr194 G T 16: 59,119,349 C240* probably null Het
Olfr450 A T 6: 42,817,846 Y125F probably damaging Het
Olfr895 T C 9: 38,269,359 V274A probably damaging Het
Piwil4 T C 9: 14,720,087 N409S probably benign Het
Pkd1l3 CACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA CACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA 8: 109,624,039 probably benign Het
Pkhd1l1 C T 15: 44,569,986 Q3421* probably null Het
Plekha7 T A 7: 116,154,640 D664V probably damaging Het
Pon2 C T 6: 5,265,480 probably null Het
Pop4 G A 7: 38,263,225 A205V possibly damaging Het
Ppp6r3 T A 19: 3,471,030 E590D probably damaging Het
Ptpn6 T A 6: 124,732,346 I96F probably damaging Het
Rfk T A 19: 17,395,226 N37K probably benign Het
Syne1 G T 10: 5,099,527 Q7535K probably damaging Het
Tcf15 A T 2: 152,144,103 I160F probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmem160 T C 7: 16,452,964 M1T probably null Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Trnt1 T C 6: 106,774,482 F140S probably damaging Het
Ttf1 T C 2: 29,079,480 probably null Het
Vmn1r172 A T 7: 23,659,785 I32F probably benign Het
Vwc2l T A 1: 70,728,904 N42K possibly damaging Het
Other mutations in Pole
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pole APN 5 110303565 splice site probably benign
IGL00475:Pole APN 5 110291096 nonsense probably null
IGL00837:Pole APN 5 110302009 missense possibly damaging 0.91
IGL00976:Pole APN 5 110323572 missense probably benign 0.00
IGL01081:Pole APN 5 110337240 missense possibly damaging 0.92
IGL01503:Pole APN 5 110303884 missense probably damaging 1.00
IGL01640:Pole APN 5 110298266 missense probably null 0.08
IGL01987:Pole APN 5 110337232 missense probably benign 0.01
IGL02429:Pole APN 5 110299800 missense probably benign
IGL02733:Pole APN 5 110312728 splice site probably benign
IGL03102:Pole APN 5 110297073 missense probably damaging 1.00
IGL03157:Pole APN 5 110293753 missense probably benign
IGL03186:Pole APN 5 110299920 critical splice donor site probably null
IGL03271:Pole APN 5 110318319 missense probably benign
IGL03351:Pole APN 5 110301998 splice site probably benign
IGL03408:Pole APN 5 110294560 missense probably damaging 1.00
IGL03410:Pole APN 5 110324559 missense probably benign
ANU74:Pole UTSW 5 110289370 missense probably benign 0.44
PIT4495001:Pole UTSW 5 110303914 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0124:Pole UTSW 5 110303992 missense probably damaging 0.96
R0145:Pole UTSW 5 110324425 missense probably damaging 0.99
R0523:Pole UTSW 5 110303593 missense probably damaging 0.96
R0590:Pole UTSW 5 110317926 missense probably benign
R0625:Pole UTSW 5 110325550 missense possibly damaging 0.50
R0707:Pole UTSW 5 110298988 missense probably damaging 1.00
R1160:Pole UTSW 5 110295253 missense possibly damaging 0.85
R1320:Pole UTSW 5 110309129 frame shift probably null
R1384:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1626:Pole UTSW 5 110293369 missense probably benign 0.25
R1643:Pole UTSW 5 110317845 missense probably damaging 1.00
R1655:Pole UTSW 5 110335922 missense probably damaging 1.00
R1668:Pole UTSW 5 110297369 missense probably damaging 1.00
R1783:Pole UTSW 5 110297430 missense probably damaging 1.00
R1843:Pole UTSW 5 110330835 critical splice donor site probably null
R1853:Pole UTSW 5 110306853 missense possibly damaging 0.95
R1867:Pole UTSW 5 110334197 missense probably benign 0.08
R1874:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1891:Pole UTSW 5 110332542 missense probably damaging 1.00
R1928:Pole UTSW 5 110327778 missense probably benign
R2073:Pole UTSW 5 110325551 missense probably damaging 0.99
R2341:Pole UTSW 5 110330963 missense possibly damaging 0.67
R2448:Pole UTSW 5 110297092 missense probably damaging 1.00
R2504:Pole UTSW 5 110290502 splice site probably null
R3053:Pole UTSW 5 110289795 missense probably damaging 1.00
R3892:Pole UTSW 5 110336439 missense probably damaging 1.00
R3964:Pole UTSW 5 110312782 missense probably damaging 1.00
R3965:Pole UTSW 5 110312782 missense probably damaging 1.00
R4374:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4376:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4377:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4520:Pole UTSW 5 110297924 missense probably damaging 1.00
R4670:Pole UTSW 5 110306387 missense probably benign 0.01
R4778:Pole UTSW 5 110330832 missense probably benign 0.00
R4887:Pole UTSW 5 110324753 missense probably damaging 0.99
R4898:Pole UTSW 5 110290224 critical splice acceptor site probably null
R5184:Pole UTSW 5 110294934 missense possibly damaging 0.91
R5359:Pole UTSW 5 110332488 missense probably benign 0.03
R5483:Pole UTSW 5 110294568 missense probably damaging 1.00
R5529:Pole UTSW 5 110332466 missense probably benign 0.20
R5576:Pole UTSW 5 110312065 nonsense probably null
R5817:Pole UTSW 5 110312972 missense probably damaging 1.00
R5877:Pole UTSW 5 110332463 missense probably benign
R5956:Pole UTSW 5 110337287 unclassified probably benign
R5990:Pole UTSW 5 110302144 missense probably damaging 1.00
R6019:Pole UTSW 5 110324514 missense probably benign 0.01
R6019:Pole UTSW 5 110324515 missense probably benign 0.01
R6093:Pole UTSW 5 110312090 missense probably benign 0.01
R6376:Pole UTSW 5 110336374 missense probably damaging 0.99
R6494:Pole UTSW 5 110324722 missense possibly damaging 0.86
R6535:Pole UTSW 5 110324807 missense probably damaging 1.00
R6723:Pole UTSW 5 110323616 missense probably benign 0.11
R6757:Pole UTSW 5 110303610 missense probably damaging 1.00
R6930:Pole UTSW 5 110293290 missense probably benign 0.01
R6988:Pole UTSW 5 110329583 missense probably damaging 0.97
R6992:Pole UTSW 5 110332499 missense probably damaging 0.99
R7067:Pole UTSW 5 110334218 missense probably damaging 1.00
R7097:Pole UTSW 5 110325102 splice site probably null
R7122:Pole UTSW 5 110325102 splice site probably null
R7202:Pole UTSW 5 110297107 missense possibly damaging 0.94
R7340:Pole UTSW 5 110334464 missense probably benign 0.06
R7345:Pole UTSW 5 110303903 missense possibly damaging 0.82
R7509:Pole UTSW 5 110330705 start gained probably benign
R7557:Pole UTSW 5 110312994 missense probably damaging 1.00
R7740:Pole UTSW 5 110331041 missense probably benign 0.00
R7792:Pole UTSW 5 110297466 splice site probably null
R7832:Pole UTSW 5 110317797 missense probably benign 0.00
R7849:Pole UTSW 5 110332548 missense probably benign 0.04
R7852:Pole UTSW 5 110306829 missense probably damaging 1.00
R7960:Pole UTSW 5 110289861 missense possibly damaging 0.81
R8001:Pole UTSW 5 110312734 missense probably damaging 1.00
R8266:Pole UTSW 5 110294920 missense probably damaging 1.00
R8510:Pole UTSW 5 110334446 missense probably damaging 0.99
R8793:Pole UTSW 5 110297748 missense probably damaging 1.00
R8835:Pole UTSW 5 110306909 missense probably damaging 1.00
R8929:Pole UTSW 5 110297788 missense probably damaging 0.98
X0064:Pole UTSW 5 110317904 nonsense probably null
Y5377:Pole UTSW 5 110294891 critical splice acceptor site probably null
Y5380:Pole UTSW 5 110294891 critical splice acceptor site probably null
Z1088:Pole UTSW 5 110327865 missense possibly damaging 0.66
Z1177:Pole UTSW 5 110297009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAATGGTGAAACCTGGTTCTC -3'
(R):5'- GTATAACGGTTCCTCGGTGG -3'

Sequencing Primer
(F):5'- CTTCTTTTACTCAGGGATGATGGTCC -3'
(R):5'- CTGAGAGCTAACAGCACTTTGTG -3'
Posted On2021-07-15