Incidental Mutation 'R8863:1600015I10Rik'
ID 675759
Institutional Source Beutler Lab
Gene Symbol 1600015I10Rik
Ensembl Gene ENSMUSG00000029813
Gene Name RIKEN cDNA 1600015I10 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock # R8863 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 48929895-48933687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48930108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 14 (L14P)
Ref Sequence ENSEMBL: ENSMUSP00000031837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031837]
AlphaFold E9Q745
Predicted Effect probably benign
Transcript: ENSMUST00000031837
AA Change: L14P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000031837
Gene: ENSMUSG00000029813
AA Change: L14P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 50 136 1.7e-25 PFAM
Pfam:Cu_amine_oxidN3 152 252 3.5e-16 PFAM
Pfam:Cu_amine_oxid 306 708 7.1e-94 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,951 S157P possibly damaging Het
9530053A07Rik A G 7: 28,131,581 D73G probably damaging Het
Aasdhppt C A 9: 4,309,424 A5S possibly damaging Het
Asb16 T C 11: 102,277,232 Y373H probably damaging Het
Axin1 T C 17: 26,143,401 S240P probably benign Het
C2cd5 T C 6: 143,041,362 I505V possibly damaging Het
Camk2g A G 14: 20,760,176 L305P probably damaging Het
Ccm2 A G 11: 6,585,211 K156E probably damaging Het
Cdh23 G T 10: 60,376,834 Y1600* probably null Het
Cyp2c29 A G 19: 39,273,366 Q16R probably benign Het
Ebf1 T A 11: 44,883,839 V221E probably damaging Het
Gtpbp1 A G 15: 79,707,061 E125G possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igfbp3 A G 11: 7,213,568 C75R probably damaging Het
Itgb4 T A 11: 115,985,072 C478* probably null Het
L3mbtl4 T A 17: 68,679,424 C488S probably benign Het
Lysmd4 T C 7: 67,223,745 S43P probably damaging Het
Mocs2 A G 13: 114,826,279 K167E probably damaging Het
Mpl C A 4: 118,457,405 V23F Het
Muc4 A T 16: 32,751,462 I447F possibly damaging Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Ncf2 A G 1: 152,836,113 *526W probably null Het
Oas1a C T 5: 120,905,880 G63D probably damaging Het
Olfr194 G T 16: 59,119,349 C240* probably null Het
Olfr450 A T 6: 42,817,846 Y125F probably damaging Het
Olfr895 T C 9: 38,269,359 V274A probably damaging Het
Piwil4 T C 9: 14,720,087 N409S probably benign Het
Pkhd1l1 C T 15: 44,569,986 Q3421* probably null Het
Plekha7 T A 7: 116,154,640 D664V probably damaging Het
Pole T C 5: 110,289,367 M66T possibly damaging Het
Pon2 C T 6: 5,265,480 probably null Het
Pop4 G A 7: 38,263,225 A205V possibly damaging Het
Ppp6r3 T A 19: 3,471,030 E590D probably damaging Het
Ptpn6 T A 6: 124,732,346 I96F probably damaging Het
Rfk T A 19: 17,395,226 N37K probably benign Het
Syne1 G T 10: 5,099,527 Q7535K probably damaging Het
Tcf15 A T 2: 152,144,103 I160F probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmem160 T C 7: 16,452,964 M1T probably null Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Trnt1 T C 6: 106,774,482 F140S probably damaging Het
Ttf1 T C 2: 29,079,480 probably null Het
Vmn1r172 A T 7: 23,659,785 I32F probably benign Het
Vwc2l T A 1: 70,728,904 N42K possibly damaging Het
Other mutations in 1600015I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:1600015I10Rik APN 6 48931040 missense probably damaging 1.00
IGL01347:1600015I10Rik APN 6 48932543 missense probably benign 0.02
IGL01751:1600015I10Rik APN 6 48930588 missense possibly damaging 0.79
IGL01915:1600015I10Rik APN 6 48931648 missense probably damaging 1.00
IGL02669:1600015I10Rik APN 6 48931473 missense probably damaging 1.00
IGL03033:1600015I10Rik APN 6 48932518 missense probably benign 0.00
IGL03242:1600015I10Rik APN 6 48932545 missense possibly damaging 0.68
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0448:1600015I10Rik UTSW 6 48933057 missense probably damaging 1.00
R1488:1600015I10Rik UTSW 6 48933447 missense possibly damaging 0.91
R1498:1600015I10Rik UTSW 6 48931371 missense probably benign 0.00
R1520:1600015I10Rik UTSW 6 48931297 nonsense probably null
R1922:1600015I10Rik UTSW 6 48931286 missense probably benign 0.00
R1992:1600015I10Rik UTSW 6 48930769 missense probably damaging 1.00
R1997:1600015I10Rik UTSW 6 48932429 missense probably damaging 0.98
R2021:1600015I10Rik UTSW 6 48931451 missense probably damaging 1.00
R3771:1600015I10Rik UTSW 6 48931196 missense probably damaging 1.00
R4208:1600015I10Rik UTSW 6 48931647 missense probably damaging 1.00
R4790:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5114:1600015I10Rik UTSW 6 48931358 missense probably benign 0.02
R5610:1600015I10Rik UTSW 6 48931019 missense probably benign 0.00
R5823:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5847:1600015I10Rik UTSW 6 48933478 missense probably damaging 1.00
R6233:1600015I10Rik UTSW 6 48930965 missense probably benign
R6357:1600015I10Rik UTSW 6 48930974 missense probably benign 0.00
R6694:1600015I10Rik UTSW 6 48930546 missense probably benign 0.21
R6733:1600015I10Rik UTSW 6 48930530 missense probably damaging 1.00
R6894:1600015I10Rik UTSW 6 48930662 missense probably damaging 1.00
R6898:1600015I10Rik UTSW 6 48931041 missense probably damaging 0.97
R6916:1600015I10Rik UTSW 6 48931053 missense probably benign 0.01
R7242:1600015I10Rik UTSW 6 48931128 missense probably damaging 1.00
R7762:1600015I10Rik UTSW 6 48932686 missense probably benign 0.07
R8257:1600015I10Rik UTSW 6 48932497 missense probably benign 0.04
R8391:1600015I10Rik UTSW 6 48932668 missense probably damaging 0.96
R8839:1600015I10Rik UTSW 6 48931040 missense probably damaging 1.00
R9266:1600015I10Rik UTSW 6 48930237 missense probably benign 0.00
R9274:1600015I10Rik UTSW 6 48930407 missense possibly damaging 0.94
R9380:1600015I10Rik UTSW 6 48933130 missense probably damaging 1.00
R9382:1600015I10Rik UTSW 6 48930364 missense probably benign 0.08
R9562:1600015I10Rik UTSW 6 48930975 missense not run
R9565:1600015I10Rik UTSW 6 48930975 missense not run
X0062:1600015I10Rik UTSW 6 48933132 missense possibly damaging 0.55
Z1176:1600015I10Rik UTSW 6 48932468 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGACCTACACAGTGCTGAGG -3'
(R):5'- GGTATACTGAGTTCTTGCCCAAAG -3'

Sequencing Primer
(F):5'- CCTACACAGTGCTGAGGTCTGTG -3'
(R):5'- CCAAAGTTGGTGTCTCAGATGGC -3'
Posted On 2021-07-15