Incidental Mutation 'R8863:Olfr895'
ID 675776
Institutional Source Beutler Lab
Gene Symbol Olfr895
Ensembl Gene ENSMUSG00000096427
Gene Name olfactory receptor 895
Synonyms MOR170-1, GA_x6K02T2PVTD-31962461-31963411
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock # R8863 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 38267851-38269735 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38269359 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 274 (V274A)
Ref Sequence ENSEMBL: ENSMUSP00000148605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093864] [ENSMUST00000212156]
AlphaFold L7N210
Predicted Effect probably damaging
Transcript: ENSMUST00000093864
AA Change: V282A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091387
Gene: ENSMUSG00000096427
AA Change: V282A

DomainStartEndE-ValueType
Pfam:7tm_4 37 313 4.6e-47 PFAM
Pfam:7tm_1 47 246 3.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212156
AA Change: V274A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,108 L14P probably benign Het
9130023H24Rik A G 7: 128,236,951 S157P possibly damaging Het
9530053A07Rik A G 7: 28,131,581 D73G probably damaging Het
Aasdhppt C A 9: 4,309,424 A5S possibly damaging Het
Asb16 T C 11: 102,277,232 Y373H probably damaging Het
Axin1 T C 17: 26,143,401 S240P probably benign Het
C2cd5 T C 6: 143,041,362 I505V possibly damaging Het
Camk2g A G 14: 20,760,176 L305P probably damaging Het
Ccm2 A G 11: 6,585,211 K156E probably damaging Het
Cdh23 G T 10: 60,376,834 Y1600* probably null Het
Cyp2c29 A G 19: 39,273,366 Q16R probably benign Het
Ebf1 T A 11: 44,883,839 V221E probably damaging Het
Gtpbp1 A G 15: 79,707,061 E125G possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igfbp3 A G 11: 7,213,568 C75R probably damaging Het
Itgb4 T A 11: 115,985,072 C478* probably null Het
L3mbtl4 T A 17: 68,679,424 C488S probably benign Het
Lysmd4 T C 7: 67,223,745 S43P probably damaging Het
Mocs2 A G 13: 114,826,279 K167E probably damaging Het
Mpl C A 4: 118,457,405 V23F Het
Muc4 A T 16: 32,751,462 I447F possibly damaging Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Ncf2 A G 1: 152,836,113 *526W probably null Het
Oas1a C T 5: 120,905,880 G63D probably damaging Het
Olfr194 G T 16: 59,119,349 C240* probably null Het
Olfr450 A T 6: 42,817,846 Y125F probably damaging Het
Piwil4 T C 9: 14,720,087 N409S probably benign Het
Pkhd1l1 C T 15: 44,569,986 Q3421* probably null Het
Plekha7 T A 7: 116,154,640 D664V probably damaging Het
Pole T C 5: 110,289,367 M66T possibly damaging Het
Pon2 C T 6: 5,265,480 probably null Het
Pop4 G A 7: 38,263,225 A205V possibly damaging Het
Ppp6r3 T A 19: 3,471,030 E590D probably damaging Het
Ptpn6 T A 6: 124,732,346 I96F probably damaging Het
Rfk T A 19: 17,395,226 N37K probably benign Het
Syne1 G T 10: 5,099,527 Q7535K probably damaging Het
Tcf15 A T 2: 152,144,103 I160F probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmem160 T C 7: 16,452,964 M1T probably null Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Trnt1 T C 6: 106,774,482 F140S probably damaging Het
Ttf1 T C 2: 29,079,480 probably null Het
Vmn1r172 A T 7: 23,659,785 I32F probably benign Het
Vwc2l T A 1: 70,728,904 N42K possibly damaging Het
Other mutations in Olfr895
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Olfr895 APN 9 38268505 splice site probably benign
IGL01477:Olfr895 APN 9 38269319 missense possibly damaging 0.74
IGL02150:Olfr895 APN 9 38269268 missense possibly damaging 0.56
R0616:Olfr895 UTSW 9 38269334 missense probably benign 0.08
R0738:Olfr895 UTSW 9 38269125 missense possibly damaging 0.93
R3155:Olfr895 UTSW 9 38268540 start codon destroyed probably null 0.98
R3824:Olfr895 UTSW 9 38268518 missense probably benign
R3825:Olfr895 UTSW 9 38268518 missense probably benign
R4023:Olfr895 UTSW 9 38269461 missense possibly damaging 0.83
R4687:Olfr895 UTSW 9 38269414 missense probably damaging 1.00
R4692:Olfr895 UTSW 9 38268530 nonsense probably null
R6171:Olfr895 UTSW 9 38268602 nonsense probably null
R6736:Olfr895 UTSW 9 38268570 missense probably damaging 1.00
R6950:Olfr895 UTSW 9 38268546 missense probably damaging 1.00
R7256:Olfr895 UTSW 9 38268708 missense probably damaging 0.98
R7774:Olfr895 UTSW 9 38269359 missense probably damaging 0.99
R7937:Olfr895 UTSW 9 38269048 missense probably benign 0.16
R8354:Olfr895 UTSW 9 38269217 missense probably benign 0.02
R8772:Olfr895 UTSW 9 38268935 missense probably benign 0.00
R9371:Olfr895 UTSW 9 38268630 missense possibly damaging 0.94
Z1088:Olfr895 UTSW 9 38268612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTACAGCTATTATCTTATGTTGCC -3'
(R):5'- AGAAGCAGTAGATATGACACCATC -3'

Sequencing Primer
(F):5'- TAAGGGTTGGTCCAAAGC -3'
(R):5'- GCAGTAGATATGACACCATCTTAAAC -3'
Posted On 2021-07-15