Mutagenetix > Incidental Mutation

Incidental Mutation 'R8864:Lrriq3'

675800

Institutional Source

Beutler Lab

Gene Symbol

Lrriq3

Ensembl Gene

ENSMUSG00000028182

Gene Name

leucine-rich repeats and IQ motif containing 3

Synonyms

4930511J15Rik, 4930438B07Rik, 4933403H06Rik, Lrrc44

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R8864 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

155093434-155194280 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 155187938 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 425 (D425E)

Ref Sequence

ENSEMBL: ENSMUSP00000029833 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029833]

AlphaFold

Q14DL3

Predicted Effect

probably damaging
Transcript: ENSMUST00000029833
AA Change: D425E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029833
Gene: ENSMUSG00000028182
AA Change: D425E

Domain	Start	End	E-Value	Type
SCOP:d1dcea3	36	155	3e-14	SMART
Blast:LRR	71	94	3e-6	BLAST
Blast:LRR	96	118	1e-5	BLAST
IQ	214	236	3.68e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (41/41)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	T	A	18: 58,890,425	C297*	probably null	Het
Adamts3	T	C	5: 89,707,122		probably benign	Het
Best2	T	A	8: 85,009,313	M331L	probably benign	Het
Cachd1	T	A	4: 100,994,829	S1207R	probably damaging	Het
Cacna2d3	G	T	14: 29,333,778	N298K	probably damaging	Het
Cyp2j12	T	C	4: 96,121,513	Y203C	probably damaging	Het
Dnah8	T	C	17: 30,762,642	I3046T	possibly damaging	Het
Eif3b	T	C	5: 140,426,532	V252A	probably benign	Het
Ergic2	A	G	6: 148,181,895	V355A	probably benign	Het
F13a1	C	T	13: 36,877,779	G670D	probably damaging	Het
Gfpt1	T	A	6: 87,054,623	D82E	probably benign	Het
Ggnbp2	G	A	11: 84,840,076	R376C	probably damaging	Het
Gm30302	T	C	13: 49,787,512	N241D	probably benign	Het
Grn	T	C	11: 102,436,385	F191L	unknown	Het
Ighv1-16	C	T	12: 114,665,999	G56D	probably benign	Het
Jrkl	T	C	9: 13,244,321	D445G	probably benign	Het
Loxl3	A	G	6: 83,035,758	T93A	probably damaging	Het
Lrp1b	C	T	2: 41,112,706	A2094T		Het
Majin	T	C	19: 6,211,620	V55A	possibly damaging	Het
Mapk8ip3	A	T	17: 24,899,518	V1192E	probably damaging	Het
Mdga1	T	C	17: 29,931,321	S106G	unknown	Het
Mtch2	C	T	2: 90,854,930	R135*	probably null	Het
Naip1	T	C	13: 100,426,320	N779S	possibly damaging	Het
Nfia	T	C	4: 98,063,145	V403A	possibly damaging	Het
Npas4	C	A	19: 4,988,528	D121Y	probably damaging	Het
Rab3gap1	C	T	1: 127,909,893	R231W	probably damaging	Het
Rangap1	C	G	15: 81,726,069		probably benign	Het
Rgs5	T	A	1: 169,690,421	F75I	probably benign	Het
Rnf19a	T	C	15: 36,265,306	D215G	possibly damaging	Het
Rwdd4a	A	T	8: 47,547,841		probably benign	Het
Setd5	G	A	6: 113,111,508	R199H	probably damaging	Het
Spef2	T	C	15: 9,599,747	Q2004R	unknown	Het
Syne1	T	C	10: 5,420,473	K236E	probably benign	Het
Tas2r104	A	G	6: 131,685,669	F26L	possibly damaging	Het
Tbc1d32	T	A	10: 56,087,559	E954D	probably benign	Het
Tenm2	A	C	11: 36,027,195	S1914A	possibly damaging	Het
Tln2	G	T	9: 67,330,552	Y32*	probably null	Het
Tnc	C	T	4: 63,993,059	R1425H	probably damaging	Het
Unc13b	T	C	4: 43,174,724	C1851R	unknown	Het
Wapl	T	A	14: 34,692,202	D340E	probably benign	Het
Zfp74	T	C	7: 29,934,810	E491G	probably damaging	Het

Other mutations in Lrriq3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Lrriq3	APN	3	155101061	missense	probably benign	0.29
IGL00468:Lrriq3	APN	3	155101179	missense	probably damaging	1.00
IGL03272:Lrriq3	APN	3	155101058	missense	probably damaging	0.99
PIT1430001:Lrriq3	UTSW	3	155098870	missense	probably benign	0.36
R0526:Lrriq3	UTSW	3	155188297	missense	probably benign	0.00
R0600:Lrriq3	UTSW	3	155187736	missense	possibly damaging	0.51
R1420:Lrriq3	UTSW	3	155187712	missense	probably benign
R2313:Lrriq3	UTSW	3	155164023	missense	probably benign	0.00
R4024:Lrriq3	UTSW	3	155188302	missense	probably benign	0.43
R4659:Lrriq3	UTSW	3	155129453	missense	possibly damaging	0.47
R4801:Lrriq3	UTSW	3	155187970	missense	probably benign
R4802:Lrriq3	UTSW	3	155187970	missense	probably benign
R4864:Lrriq3	UTSW	3	155187810	missense	possibly damaging	0.91
R4998:Lrriq3	UTSW	3	155188058	missense	probably benign	0.13
R5120:Lrriq3	UTSW	3	155129384	missense	probably benign	0.14
R5319:Lrriq3	UTSW	3	155129471	missense	possibly damaging	0.88
R5406:Lrriq3	UTSW	3	155129501	critical splice donor site	probably null
R5943:Lrriq3	UTSW	3	155163950	missense	probably damaging	0.99
R6184:Lrriq3	UTSW	3	155129402	missense	probably benign	0.09
R6572:Lrriq3	UTSW	3	155181675	missense	probably benign	0.01
R7389:Lrriq3	UTSW	3	155188104	missense	probably benign	0.00
R7537:Lrriq3	UTSW	3	155101097	missense	probably damaging	1.00
R7636:Lrriq3	UTSW	3	155188150	missense	probably damaging	1.00
R7806:Lrriq3	UTSW	3	155098807	missense	probably damaging	0.99
R8038:Lrriq3	UTSW	3	155164001	missense	probably benign	0.03
R8361:Lrriq3	UTSW	3	155101218	nonsense	probably null
R8439:Lrriq3	UTSW	3	155188236	missense	probably damaging	0.99
R8771:Lrriq3	UTSW	3	155193633	missense	probably damaging	1.00
R8929:Lrriq3	UTSW	3	155188182	missense	probably damaging	1.00
R9134:Lrriq3	UTSW	3	155114546	critical splice donor site	probably null
R9792:Lrriq3	UTSW	3	155187676	missense	probably benign
R9793:Lrriq3	UTSW	3	155187676	missense	probably benign
R9795:Lrriq3	UTSW	3	155187676	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCACTCAAGTACGGGGCAATG -3'
(R):5'- TTTTCCAGGTAGGCGAGTCTC -3'

Sequencing Primer
(F):5'- TACGGGGCAATGCTGAAG -3'
(R):5'- GCTGTAAGCCTTTCTGAATTGTC -3'

Posted On

2021-07-15