Incidental Mutation 'R8864:Cachd1'
ID 675805
Institutional Source Beutler Lab
Gene Symbol Cachd1
Ensembl Gene ENSMUSG00000028532
Gene Name cache domain containing 1
Synonyms Vwcd1, B430218L07Rik, 1190007F10Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.295) question?
Stock # R8864 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 100776675-101029220 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 100994829 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1207 (S1207R)
Ref Sequence ENSEMBL: ENSMUSP00000030257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030257] [ENSMUST00000097955]
AlphaFold Q6PDJ1
Predicted Effect probably damaging
Transcript: ENSMUST00000030257
AA Change: S1207R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030257
Gene: ENSMUSG00000028532
AA Change: S1207R

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:VWA_N 103 218 9.4e-22 PFAM
VWA 240 438 2.8e-1 SMART
Pfam:Cache_1 467 543 2.4e-12 PFAM
Pfam:Cache_1 786 871 1.5e-7 PFAM
low complexity region 981 996 N/A INTRINSIC
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1240 1246 N/A INTRINSIC
low complexity region 1260 1274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097955
AA Change: S1207R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095568
Gene: ENSMUSG00000028532
AA Change: S1207R

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:VWA_N 103 218 6.7e-32 PFAM
VWA 240 438 2.8e-1 SMART
Pfam:Cache_1 467 543 1.7e-12 PFAM
low complexity region 801 818 N/A INTRINSIC
low complexity region 981 996 N/A INTRINSIC
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
Meta Mutation Damage Score 0.5363 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 T A 18: 58,890,425 C297* probably null Het
Adamts3 T C 5: 89,707,122 probably benign Het
Best2 T A 8: 85,009,313 M331L probably benign Het
Cacna2d3 G T 14: 29,333,778 N298K probably damaging Het
Cyp2j12 T C 4: 96,121,513 Y203C probably damaging Het
Dnah8 T C 17: 30,762,642 I3046T possibly damaging Het
Eif3b T C 5: 140,426,532 V252A probably benign Het
Ergic2 A G 6: 148,181,895 V355A probably benign Het
F13a1 C T 13: 36,877,779 G670D probably damaging Het
Gfpt1 T A 6: 87,054,623 D82E probably benign Het
Ggnbp2 G A 11: 84,840,076 R376C probably damaging Het
Gm30302 T C 13: 49,787,512 N241D probably benign Het
Grn T C 11: 102,436,385 F191L unknown Het
Ighv1-16 C T 12: 114,665,999 G56D probably benign Het
Jrkl T C 9: 13,244,321 D445G probably benign Het
Loxl3 A G 6: 83,035,758 T93A probably damaging Het
Lrp1b C T 2: 41,112,706 A2094T Het
Lrriq3 T A 3: 155,187,938 D425E probably damaging Het
Majin T C 19: 6,211,620 V55A possibly damaging Het
Mapk8ip3 A T 17: 24,899,518 V1192E probably damaging Het
Mdga1 T C 17: 29,931,321 S106G unknown Het
Mtch2 C T 2: 90,854,930 R135* probably null Het
Naip1 T C 13: 100,426,320 N779S possibly damaging Het
Nfia T C 4: 98,063,145 V403A possibly damaging Het
Npas4 C A 19: 4,988,528 D121Y probably damaging Het
Rab3gap1 C T 1: 127,909,893 R231W probably damaging Het
Rangap1 C G 15: 81,726,069 probably benign Het
Rgs5 T A 1: 169,690,421 F75I probably benign Het
Rnf19a T C 15: 36,265,306 D215G possibly damaging Het
Rwdd4a A T 8: 47,547,841 probably benign Het
Setd5 G A 6: 113,111,508 R199H probably damaging Het
Spef2 T C 15: 9,599,747 Q2004R unknown Het
Syne1 T C 10: 5,420,473 K236E probably benign Het
Tas2r104 A G 6: 131,685,669 F26L possibly damaging Het
Tbc1d32 T A 10: 56,087,559 E954D probably benign Het
Tenm2 A C 11: 36,027,195 S1914A possibly damaging Het
Tln2 G T 9: 67,330,552 Y32* probably null Het
Tnc C T 4: 63,993,059 R1425H probably damaging Het
Unc13b T C 4: 43,174,724 C1851R unknown Het
Wapl T A 14: 34,692,202 D340E probably benign Het
Zfp74 T C 7: 29,934,810 E491G probably damaging Het
Other mutations in Cachd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Cachd1 APN 4 100966966 missense probably benign 0.05
IGL01531:Cachd1 APN 4 100953034 missense probably benign 0.02
IGL01705:Cachd1 APN 4 100983539 missense possibly damaging 0.46
IGL01843:Cachd1 APN 4 100992872 missense probably damaging 0.98
IGL01938:Cachd1 APN 4 100974128 missense possibly damaging 0.59
IGL02268:Cachd1 APN 4 100952097 missense possibly damaging 0.75
IGL02934:Cachd1 APN 4 100968098 missense probably damaging 0.98
IGL03019:Cachd1 APN 4 100952085 missense probably damaging 0.98
IGL03084:Cachd1 APN 4 101003088 missense probably damaging 0.99
R0366:Cachd1 UTSW 4 100994737 missense possibly damaging 0.94
R0395:Cachd1 UTSW 4 100953205 missense probably damaging 1.00
R0520:Cachd1 UTSW 4 100897703 missense probably damaging 0.99
R0578:Cachd1 UTSW 4 100994842 splice site probably benign
R0646:Cachd1 UTSW 4 100988221 missense probably damaging 1.00
R0689:Cachd1 UTSW 4 100974876 missense probably damaging 1.00
R0962:Cachd1 UTSW 4 100983301 splice site probably benign
R1156:Cachd1 UTSW 4 100988619 missense probably damaging 1.00
R1157:Cachd1 UTSW 4 100974840 missense possibly damaging 0.77
R1314:Cachd1 UTSW 4 100974917 missense probably damaging 1.00
R1482:Cachd1 UTSW 4 100988598 missense possibly damaging 0.94
R1632:Cachd1 UTSW 4 100966972 missense probably benign 0.02
R1774:Cachd1 UTSW 4 100964435 missense probably damaging 1.00
R1774:Cachd1 UTSW 4 100967043 missense probably benign 0.02
R1845:Cachd1 UTSW 4 100777358 missense probably benign 0.01
R1869:Cachd1 UTSW 4 100983390 missense probably damaging 1.00
R1912:Cachd1 UTSW 4 100953169 missense probably damaging 0.99
R2069:Cachd1 UTSW 4 100990844 missense probably damaging 1.00
R2082:Cachd1 UTSW 4 101002958 missense probably damaging 1.00
R2267:Cachd1 UTSW 4 100949069 splice site probably benign
R2517:Cachd1 UTSW 4 100980882 splice site probably null
R2896:Cachd1 UTSW 4 100970903 missense probably damaging 1.00
R3729:Cachd1 UTSW 4 100974880 nonsense probably null
R3818:Cachd1 UTSW 4 100990865 missense probably damaging 1.00
R3979:Cachd1 UTSW 4 100970888 missense probably damaging 1.00
R4647:Cachd1 UTSW 4 100953130 nonsense probably null
R4791:Cachd1 UTSW 4 100918085 missense probably damaging 1.00
R5133:Cachd1 UTSW 4 100994738 missense probably damaging 0.98
R5147:Cachd1 UTSW 4 100964491 missense probably damaging 1.00
R5187:Cachd1 UTSW 4 100966200 missense possibly damaging 0.94
R5322:Cachd1 UTSW 4 100952122 missense probably damaging 0.98
R5335:Cachd1 UTSW 4 100968085 missense possibly damaging 0.88
R5390:Cachd1 UTSW 4 100981006 missense probably damaging 1.00
R5573:Cachd1 UTSW 4 100974079 missense probably damaging 0.99
R5578:Cachd1 UTSW 4 100865006 missense probably benign 0.31
R5905:Cachd1 UTSW 4 100983556 missense probably damaging 0.99
R6003:Cachd1 UTSW 4 100952019 missense possibly damaging 0.79
R6028:Cachd1 UTSW 4 100983556 missense probably damaging 0.99
R6185:Cachd1 UTSW 4 100981031 nonsense probably null
R6367:Cachd1 UTSW 4 101002970 missense probably damaging 1.00
R6492:Cachd1 UTSW 4 100952118 missense possibly damaging 0.89
R6591:Cachd1 UTSW 4 100989486 missense probably benign
R6691:Cachd1 UTSW 4 100989486 missense probably benign
R7129:Cachd1 UTSW 4 100918066 missense probably null 0.99
R7187:Cachd1 UTSW 4 100976355 missense possibly damaging 0.95
R7387:Cachd1 UTSW 4 100777178 missense unknown
R7833:Cachd1 UTSW 4 100974815 missense probably benign 0.09
R7835:Cachd1 UTSW 4 100974153 splice site probably null
R7838:Cachd1 UTSW 4 100967014 missense possibly damaging 0.71
R7867:Cachd1 UTSW 4 100988562 missense probably damaging 0.97
R7882:Cachd1 UTSW 4 100967047 missense probably benign 0.29
R7941:Cachd1 UTSW 4 100988173 missense probably damaging 1.00
R7978:Cachd1 UTSW 4 100974863 missense probably damaging 1.00
R8085:Cachd1 UTSW 4 100988164 missense probably damaging 1.00
R8153:Cachd1 UTSW 4 100988638 critical splice donor site probably null
R8174:Cachd1 UTSW 4 100966269 missense probably damaging 0.99
R8219:Cachd1 UTSW 4 100990962 missense probably benign 0.34
R8358:Cachd1 UTSW 4 100959471 missense possibly damaging 0.94
R8376:Cachd1 UTSW 4 100974876 missense probably damaging 0.99
R8686:Cachd1 UTSW 4 100988128 missense probably damaging 0.99
R8747:Cachd1 UTSW 4 101002848 intron probably benign
R8845:Cachd1 UTSW 4 100953146 missense probably benign 0.36
R8869:Cachd1 UTSW 4 100952083 missense probably benign 0.09
R8870:Cachd1 UTSW 4 100897781 missense probably damaging 0.99
R8904:Cachd1 UTSW 4 100953166 missense probably damaging 1.00
R8958:Cachd1 UTSW 4 100994086 missense probably benign 0.11
R9061:Cachd1 UTSW 4 100952005 critical splice acceptor site probably null
R9193:Cachd1 UTSW 4 100777142 missense unknown
R9304:Cachd1 UTSW 4 100966982 missense possibly damaging 0.81
R9358:Cachd1 UTSW 4 100976425 missense probably damaging 0.99
R9373:Cachd1 UTSW 4 100974870 missense possibly damaging 0.94
R9425:Cachd1 UTSW 4 100974860 missense probably benign
R9632:Cachd1 UTSW 4 100974895 missense probably benign 0.34
R9710:Cachd1 UTSW 4 100974895 missense probably benign 0.34
R9751:Cachd1 UTSW 4 100966241 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTAACTTCTGAAAGACTGACCCTTCC -3'
(R):5'- AGGGCCCTTTAGCTTGACAC -3'

Sequencing Primer
(F):5'- TGACCCTTCCAACACGTGAG -3'
(R):5'- AGCTTGACACTTTTCTCAAACCATG -3'
Posted On 2021-07-15