Mutagenetix > Incidental Mutation

Incidental Mutation 'R8864:Cachd1'

675805

Institutional Source

Beutler Lab

Gene Symbol

Cachd1

Ensembl Gene

ENSMUSG00000028532

Gene Name

cache domain containing 1

Synonyms

Vwcd1, B430218L07Rik, 1190007F10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.295) question?

Stock #

R8864 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100776675-101029220 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 100994829 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1207 (S1207R)

Ref Sequence

ENSEMBL: ENSMUSP00000030257 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030257] [ENSMUST00000097955]

AlphaFold

Q6PDJ1

Predicted Effect

probably damaging
Transcript: ENSMUST00000030257
AA Change: S1207R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000030257
Gene: ENSMUSG00000028532
AA Change: S1207R

Domain	Start	End	E-Value	Type
low complexity region	11	24	N/A	INTRINSIC
Pfam:VWA_N	103	218	9.4e-22	PFAM
VWA	240	438	2.8e-1	SMART
Pfam:Cache_1	467	543	2.4e-12	PFAM
Pfam:Cache_1	786	871	1.5e-7	PFAM
low complexity region	981	996	N/A	INTRINSIC
transmembrane domain	1109	1131	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1240	1246	N/A	INTRINSIC
low complexity region	1260	1274	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000097955
AA Change: S1207R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000095568
Gene: ENSMUSG00000028532
AA Change: S1207R

Domain	Start	End	E-Value	Type
low complexity region	11	24	N/A	INTRINSIC
Pfam:VWA_N	103	218	6.7e-32	PFAM
VWA	240	438	2.8e-1	SMART
Pfam:Cache_1	467	543	1.7e-12	PFAM
low complexity region	801	818	N/A	INTRINSIC
low complexity region	981	996	N/A	INTRINSIC
transmembrane domain	1109	1131	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC

Meta Mutation Damage Score

0.5363

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (41/41)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	T	A	18: 58,890,425	C297*	probably null	Het
Adamts3	T	C	5: 89,707,122		probably benign	Het
Best2	T	A	8: 85,009,313	M331L	probably benign	Het
Cacna2d3	G	T	14: 29,333,778	N298K	probably damaging	Het
Cyp2j12	T	C	4: 96,121,513	Y203C	probably damaging	Het
Dnah8	T	C	17: 30,762,642	I3046T	possibly damaging	Het
Eif3b	T	C	5: 140,426,532	V252A	probably benign	Het
Ergic2	A	G	6: 148,181,895	V355A	probably benign	Het
F13a1	C	T	13: 36,877,779	G670D	probably damaging	Het
Gfpt1	T	A	6: 87,054,623	D82E	probably benign	Het
Ggnbp2	G	A	11: 84,840,076	R376C	probably damaging	Het
Gm30302	T	C	13: 49,787,512	N241D	probably benign	Het
Grn	T	C	11: 102,436,385	F191L	unknown	Het
Ighv1-16	C	T	12: 114,665,999	G56D	probably benign	Het
Jrkl	T	C	9: 13,244,321	D445G	probably benign	Het
Loxl3	A	G	6: 83,035,758	T93A	probably damaging	Het
Lrp1b	C	T	2: 41,112,706	A2094T		Het
Lrriq3	T	A	3: 155,187,938	D425E	probably damaging	Het
Majin	T	C	19: 6,211,620	V55A	possibly damaging	Het
Mapk8ip3	A	T	17: 24,899,518	V1192E	probably damaging	Het
Mdga1	T	C	17: 29,931,321	S106G	unknown	Het
Mtch2	C	T	2: 90,854,930	R135*	probably null	Het
Naip1	T	C	13: 100,426,320	N779S	possibly damaging	Het
Nfia	T	C	4: 98,063,145	V403A	possibly damaging	Het
Npas4	C	A	19: 4,988,528	D121Y	probably damaging	Het
Rab3gap1	C	T	1: 127,909,893	R231W	probably damaging	Het
Rangap1	C	G	15: 81,726,069		probably benign	Het
Rgs5	T	A	1: 169,690,421	F75I	probably benign	Het
Rnf19a	T	C	15: 36,265,306	D215G	possibly damaging	Het
Rwdd4a	A	T	8: 47,547,841		probably benign	Het
Setd5	G	A	6: 113,111,508	R199H	probably damaging	Het
Spef2	T	C	15: 9,599,747	Q2004R	unknown	Het
Syne1	T	C	10: 5,420,473	K236E	probably benign	Het
Tas2r104	A	G	6: 131,685,669	F26L	possibly damaging	Het
Tbc1d32	T	A	10: 56,087,559	E954D	probably benign	Het
Tenm2	A	C	11: 36,027,195	S1914A	possibly damaging	Het
Tln2	G	T	9: 67,330,552	Y32*	probably null	Het
Tnc	C	T	4: 63,993,059	R1425H	probably damaging	Het
Unc13b	T	C	4: 43,174,724	C1851R	unknown	Het
Wapl	T	A	14: 34,692,202	D340E	probably benign	Het
Zfp74	T	C	7: 29,934,810	E491G	probably damaging	Het

Other mutations in Cachd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Cachd1	APN	4	100966966	missense	probably benign	0.05
IGL01531:Cachd1	APN	4	100953034	missense	probably benign	0.02
IGL01705:Cachd1	APN	4	100983539	missense	possibly damaging	0.46
IGL01843:Cachd1	APN	4	100992872	missense	probably damaging	0.98
IGL01938:Cachd1	APN	4	100974128	missense	possibly damaging	0.59
IGL02268:Cachd1	APN	4	100952097	missense	possibly damaging	0.75
IGL02934:Cachd1	APN	4	100968098	missense	probably damaging	0.98
IGL03019:Cachd1	APN	4	100952085	missense	probably damaging	0.98
IGL03084:Cachd1	APN	4	101003088	missense	probably damaging	0.99
R0366:Cachd1	UTSW	4	100994737	missense	possibly damaging	0.94
R0395:Cachd1	UTSW	4	100953205	missense	probably damaging	1.00
R0520:Cachd1	UTSW	4	100897703	missense	probably damaging	0.99
R0578:Cachd1	UTSW	4	100994842	splice site	probably benign
R0646:Cachd1	UTSW	4	100988221	missense	probably damaging	1.00
R0689:Cachd1	UTSW	4	100974876	missense	probably damaging	1.00
R0962:Cachd1	UTSW	4	100983301	splice site	probably benign
R1156:Cachd1	UTSW	4	100988619	missense	probably damaging	1.00
R1157:Cachd1	UTSW	4	100974840	missense	possibly damaging	0.77
R1314:Cachd1	UTSW	4	100974917	missense	probably damaging	1.00
R1482:Cachd1	UTSW	4	100988598	missense	possibly damaging	0.94
R1632:Cachd1	UTSW	4	100966972	missense	probably benign	0.02
R1774:Cachd1	UTSW	4	100964435	missense	probably damaging	1.00
R1774:Cachd1	UTSW	4	100967043	missense	probably benign	0.02
R1845:Cachd1	UTSW	4	100777358	missense	probably benign	0.01
R1869:Cachd1	UTSW	4	100983390	missense	probably damaging	1.00
R1912:Cachd1	UTSW	4	100953169	missense	probably damaging	0.99
R2069:Cachd1	UTSW	4	100990844	missense	probably damaging	1.00
R2082:Cachd1	UTSW	4	101002958	missense	probably damaging	1.00
R2267:Cachd1	UTSW	4	100949069	splice site	probably benign
R2517:Cachd1	UTSW	4	100980882	splice site	probably null
R2896:Cachd1	UTSW	4	100970903	missense	probably damaging	1.00
R3729:Cachd1	UTSW	4	100974880	nonsense	probably null
R3818:Cachd1	UTSW	4	100990865	missense	probably damaging	1.00
R3979:Cachd1	UTSW	4	100970888	missense	probably damaging	1.00
R4647:Cachd1	UTSW	4	100953130	nonsense	probably null
R4791:Cachd1	UTSW	4	100918085	missense	probably damaging	1.00
R5133:Cachd1	UTSW	4	100994738	missense	probably damaging	0.98
R5147:Cachd1	UTSW	4	100964491	missense	probably damaging	1.00
R5187:Cachd1	UTSW	4	100966200	missense	possibly damaging	0.94
R5322:Cachd1	UTSW	4	100952122	missense	probably damaging	0.98
R5335:Cachd1	UTSW	4	100968085	missense	possibly damaging	0.88
R5390:Cachd1	UTSW	4	100981006	missense	probably damaging	1.00
R5573:Cachd1	UTSW	4	100974079	missense	probably damaging	0.99
R5578:Cachd1	UTSW	4	100865006	missense	probably benign	0.31
R5905:Cachd1	UTSW	4	100983556	missense	probably damaging	0.99
R6003:Cachd1	UTSW	4	100952019	missense	possibly damaging	0.79
R6028:Cachd1	UTSW	4	100983556	missense	probably damaging	0.99
R6185:Cachd1	UTSW	4	100981031	nonsense	probably null
R6367:Cachd1	UTSW	4	101002970	missense	probably damaging	1.00
R6492:Cachd1	UTSW	4	100952118	missense	possibly damaging	0.89
R6591:Cachd1	UTSW	4	100989486	missense	probably benign
R6691:Cachd1	UTSW	4	100989486	missense	probably benign
R7129:Cachd1	UTSW	4	100918066	missense	probably null	0.99
R7187:Cachd1	UTSW	4	100976355	missense	possibly damaging	0.95
R7387:Cachd1	UTSW	4	100777178	missense	unknown
R7833:Cachd1	UTSW	4	100974815	missense	probably benign	0.09
R7835:Cachd1	UTSW	4	100974153	splice site	probably null
R7838:Cachd1	UTSW	4	100967014	missense	possibly damaging	0.71
R7867:Cachd1	UTSW	4	100988562	missense	probably damaging	0.97
R7882:Cachd1	UTSW	4	100967047	missense	probably benign	0.29
R7941:Cachd1	UTSW	4	100988173	missense	probably damaging	1.00
R7978:Cachd1	UTSW	4	100974863	missense	probably damaging	1.00
R8085:Cachd1	UTSW	4	100988164	missense	probably damaging	1.00
R8153:Cachd1	UTSW	4	100988638	critical splice donor site	probably null
R8174:Cachd1	UTSW	4	100966269	missense	probably damaging	0.99
R8219:Cachd1	UTSW	4	100990962	missense	probably benign	0.34
R8358:Cachd1	UTSW	4	100959471	missense	possibly damaging	0.94
R8376:Cachd1	UTSW	4	100974876	missense	probably damaging	0.99
R8686:Cachd1	UTSW	4	100988128	missense	probably damaging	0.99
R8747:Cachd1	UTSW	4	101002848	intron	probably benign
R8845:Cachd1	UTSW	4	100953146	missense	probably benign	0.36
R8869:Cachd1	UTSW	4	100952083	missense	probably benign	0.09
R8870:Cachd1	UTSW	4	100897781	missense	probably damaging	0.99
R8904:Cachd1	UTSW	4	100953166	missense	probably damaging	1.00
R8958:Cachd1	UTSW	4	100994086	missense	probably benign	0.11
R9061:Cachd1	UTSW	4	100952005	critical splice acceptor site	probably null
R9193:Cachd1	UTSW	4	100777142	missense	unknown
R9304:Cachd1	UTSW	4	100966982	missense	possibly damaging	0.81
R9358:Cachd1	UTSW	4	100976425	missense	probably damaging	0.99
R9373:Cachd1	UTSW	4	100974870	missense	possibly damaging	0.94
R9425:Cachd1	UTSW	4	100974860	missense	probably benign
R9632:Cachd1	UTSW	4	100974895	missense	probably benign	0.34
R9710:Cachd1	UTSW	4	100974895	missense	probably benign	0.34
R9751:Cachd1	UTSW	4	100966241	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- CTAACTTCTGAAAGACTGACCCTTCC -3'
(R):5'- AGGGCCCTTTAGCTTGACAC -3'

Sequencing Primer
(F):5'- TGACCCTTCCAACACGTGAG -3'
(R):5'- AGCTTGACACTTTTCTCAAACCATG -3'

Posted On

2021-07-15