Mutagenetix > Incidental Mutation

Incidental Mutation 'R8864:Loxl3'

675807

Institutional Source

Beutler Lab

Gene Symbol

Loxl3

Ensembl Gene

ENSMUSG00000000693

Gene Name

lysyl oxidase-like 3

Synonyms

Lor2

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.881) question?

Stock #

R8864 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83034173-83052562 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83035758 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 93 (T93A)

Ref Sequence

ENSEMBL: ENSMUSP00000000707 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000707] [ENSMUST00000089651] [ENSMUST00000101257] [ENSMUST00000149918]

AlphaFold

Q9Z175

Predicted Effect

probably damaging
Transcript: ENSMUST00000000707
AA Change: T93A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000000707
Gene: ENSMUSG00000000693
AA Change: T93A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
SR	45	146	2.1e-50	SMART
SR	170	283	1.09e-25	SMART
SR	308	408	3.72e-51	SMART
SR	418	526	8.5e-37	SMART
Pfam:Lysyl_oxidase	530	730	3.9e-103	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000089651

SMART Domains

Protein: ENSMUSP00000087079
Gene: ENSMUSG00000068335

Domain	Start	End	E-Value	Type
PH	4	121	1.31e-8	SMART
IRS	151	254	1.21e-45	SMART
PTBI	152	254	3.84e-59	SMART
low complexity region	411	424	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101257
AA Change: T93A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000098815
Gene: ENSMUSG00000000693
AA Change: T93A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
SR	45	146	2.1e-50	SMART
SR	170	283	1.09e-25	SMART
SR	308	396	5.46e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149918

Predicted Effect

probably benign
Transcript: ENSMUST00000204900

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysyl oxidase, which likely functions as an amine oxidase and plays a role in the formation of crosslinks in collagens and elastin. Deletion of the related gene in mouse causes neonatal mortality with cleft palate, spine deformity, and defects in collagen organization. A mutation in this gene was found in a family with Stickler syndrome. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality shortly after birth, craniofacial and vertebral abnormalities associated with collagen deformities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	T	A	18: 58,890,425	C297*	probably null	Het
Adamts3	T	C	5: 89,707,122		probably benign	Het
Best2	T	A	8: 85,009,313	M331L	probably benign	Het
Cachd1	T	A	4: 100,994,829	S1207R	probably damaging	Het
Cacna2d3	G	T	14: 29,333,778	N298K	probably damaging	Het
Cyp2j12	T	C	4: 96,121,513	Y203C	probably damaging	Het
Dnah8	T	C	17: 30,762,642	I3046T	possibly damaging	Het
Eif3b	T	C	5: 140,426,532	V252A	probably benign	Het
Ergic2	A	G	6: 148,181,895	V355A	probably benign	Het
F13a1	C	T	13: 36,877,779	G670D	probably damaging	Het
Gfpt1	T	A	6: 87,054,623	D82E	probably benign	Het
Ggnbp2	G	A	11: 84,840,076	R376C	probably damaging	Het
Gm30302	T	C	13: 49,787,512	N241D	probably benign	Het
Grn	T	C	11: 102,436,385	F191L	unknown	Het
Ighv1-16	C	T	12: 114,665,999	G56D	probably benign	Het
Jrkl	T	C	9: 13,244,321	D445G	probably benign	Het
Lrp1b	C	T	2: 41,112,706	A2094T		Het
Lrriq3	T	A	3: 155,187,938	D425E	probably damaging	Het
Majin	T	C	19: 6,211,620	V55A	possibly damaging	Het
Mapk8ip3	A	T	17: 24,899,518	V1192E	probably damaging	Het
Mdga1	T	C	17: 29,931,321	S106G	unknown	Het
Mtch2	C	T	2: 90,854,930	R135*	probably null	Het
Naip1	T	C	13: 100,426,320	N779S	possibly damaging	Het
Nfia	T	C	4: 98,063,145	V403A	possibly damaging	Het
Npas4	C	A	19: 4,988,528	D121Y	probably damaging	Het
Rab3gap1	C	T	1: 127,909,893	R231W	probably damaging	Het
Rangap1	C	G	15: 81,726,069		probably benign	Het
Rgs5	T	A	1: 169,690,421	F75I	probably benign	Het
Rnf19a	T	C	15: 36,265,306	D215G	possibly damaging	Het
Rwdd4a	A	T	8: 47,547,841		probably benign	Het
Setd5	G	A	6: 113,111,508	R199H	probably damaging	Het
Spef2	T	C	15: 9,599,747	Q2004R	unknown	Het
Syne1	T	C	10: 5,420,473	K236E	probably benign	Het
Tas2r104	A	G	6: 131,685,669	F26L	possibly damaging	Het
Tbc1d32	T	A	10: 56,087,559	E954D	probably benign	Het
Tenm2	A	C	11: 36,027,195	S1914A	possibly damaging	Het
Tln2	G	T	9: 67,330,552	Y32*	probably null	Het
Tnc	C	T	4: 63,993,059	R1425H	probably damaging	Het
Unc13b	T	C	4: 43,174,724	C1851R	unknown	Het
Wapl	T	A	14: 34,692,202	D340E	probably benign	Het
Zfp74	T	C	7: 29,934,810	E491G	probably damaging	Het

Other mutations in Loxl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00957:Loxl3	APN	6	83048766	unclassified	probably benign
IGL01370:Loxl3	APN	6	83049487	missense	probably damaging	1.00
IGL02126:Loxl3	APN	6	83048647	missense	probably damaging	1.00
IGL02128:Loxl3	APN	6	83050583	missense	probably damaging	1.00
R0241:Loxl3	UTSW	6	83050133	missense	probably damaging	1.00
R0241:Loxl3	UTSW	6	83050133	missense	probably damaging	1.00
R1725:Loxl3	UTSW	6	83035593	missense	probably benign	0.00
R1771:Loxl3	UTSW	6	83049909	missense	probably damaging	1.00
R2017:Loxl3	UTSW	6	83048977	missense	probably damaging	0.99
R2291:Loxl3	UTSW	6	83037488	missense	probably benign	0.07
R3731:Loxl3	UTSW	6	83050671	critical splice donor site	probably null
R4179:Loxl3	UTSW	6	83037584	missense	probably benign	0.00
R5230:Loxl3	UTSW	6	83035794	missense	probably benign	0.16
R5385:Loxl3	UTSW	6	83050612	missense	probably damaging	0.99
R5591:Loxl3	UTSW	6	83048037	missense	probably damaging	1.00
R5664:Loxl3	UTSW	6	83049882	missense	probably benign	0.12
R5769:Loxl3	UTSW	6	83050600	missense	probably damaging	0.98
R5771:Loxl3	UTSW	6	83035799	splice site	probably null
R5802:Loxl3	UTSW	6	83049289	missense	possibly damaging	0.67
R5831:Loxl3	UTSW	6	83049018	missense	probably benign	0.01
R5945:Loxl3	UTSW	6	83037511	missense	probably damaging	1.00
R6542:Loxl3	UTSW	6	83048166	missense	probably benign	0.00
R6687:Loxl3	UTSW	6	83050664	missense	probably damaging	1.00
R7961:Loxl3	UTSW	6	83050809	missense	possibly damaging	0.88
R8009:Loxl3	UTSW	6	83050809	missense	possibly damaging	0.88
R8122:Loxl3	UTSW	6	83049259	missense	probably damaging	1.00
R8278:Loxl3	UTSW	6	83048716	missense	probably damaging	1.00
R8373:Loxl3	UTSW	6	83048891	missense	possibly damaging	0.89
R8411:Loxl3	UTSW	6	83050624	missense	probably damaging	1.00
R8539:Loxl3	UTSW	6	83049526	missense	probably benign
R8684:Loxl3	UTSW	6	83035585	missense	probably benign	0.23
R8782:Loxl3	UTSW	6	83048070	missense	probably benign
R8801:Loxl3	UTSW	6	83048648	missense	probably damaging	1.00
R8859:Loxl3	UTSW	6	83037545	missense	probably damaging	1.00
R9031:Loxl3	UTSW	6	83035522	missense	probably damaging	1.00
R9081:Loxl3	UTSW	6	83048657	missense	possibly damaging	0.67
R9176:Loxl3	UTSW	6	83049311	missense	probably damaging	0.99
R9369:Loxl3	UTSW	6	83050412	missense	probably benign	0.26
R9634:Loxl3	UTSW	6	83050854	missense	probably benign	0.10
V1024:Loxl3	UTSW	6	83035738	missense	probably damaging	1.00
X0009:Loxl3	UTSW	6	83038480	missense	probably damaging	1.00
Z1177:Loxl3	UTSW	6	83038578	nonsense	probably null
Z1177:Loxl3	UTSW	6	83048160	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTTCTATCAGCCCAGAGAAGAAGG -3'
(R):5'- TAGCTTCAGGTCACATGGCC -3'

Sequencing Primer
(F):5'- CCCAGAGAAGAAGGTAGGAAGCC -3'
(R):5'- TCAGGTCACATGGCCCTGAAATTAG -3'

Posted On

2021-07-15