Incidental Mutation 'R8864:Tbc1d32'
ID 675817
Institutional Source Beutler Lab
Gene Symbol Tbc1d32
Ensembl Gene ENSMUSG00000038122
Gene Name TBC1 domain family, member 32
Synonyms D630037F22Rik, Bromi, b2b2284Clo, C6orf170
MMRRC Submission 068680-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.902) question?
Stock # R8864 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 55890389-56104785 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55963655 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 954 (E954D)
Ref Sequence ENSEMBL: ENSMUSP00000097328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099739]
AlphaFold Q3URV1
Predicted Effect probably benign
Transcript: ENSMUST00000099739
AA Change: E954D

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: E954D

DomainStartEndE-ValueType
Pfam:BROMI 12 1293 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 T A 18: 59,023,497 (GRCm39) C297* probably null Het
Adamts3 T C 5: 89,854,981 (GRCm39) probably benign Het
Best2 T A 8: 85,735,942 (GRCm39) M331L probably benign Het
Cachd1 T A 4: 100,852,026 (GRCm39) S1207R probably damaging Het
Cacna2d3 G T 14: 29,055,735 (GRCm39) N298K probably damaging Het
Cyp2j12 T C 4: 96,009,750 (GRCm39) Y203C probably damaging Het
Dnah8 T C 17: 30,981,616 (GRCm39) I3046T possibly damaging Het
Eif3b T C 5: 140,412,287 (GRCm39) V252A probably benign Het
Ergic2 A G 6: 148,083,393 (GRCm39) V355A probably benign Het
F13a1 C T 13: 37,061,753 (GRCm39) G670D probably damaging Het
Gfpt1 T A 6: 87,031,605 (GRCm39) D82E probably benign Het
Ggnbp2 G A 11: 84,730,902 (GRCm39) R376C probably damaging Het
Grn T C 11: 102,327,211 (GRCm39) F191L unknown Het
Ighv1-16 C T 12: 114,629,619 (GRCm39) G56D probably benign Het
Jrkl T C 9: 13,244,326 (GRCm39) D445G probably benign Het
Loxl3 A G 6: 83,012,739 (GRCm39) T93A probably damaging Het
Lrp1b C T 2: 41,002,718 (GRCm39) A2094T Het
Lrriq3 T A 3: 154,893,575 (GRCm39) D425E probably damaging Het
Majin T C 19: 6,261,650 (GRCm39) V55A possibly damaging Het
Mapk8ip3 A T 17: 25,118,492 (GRCm39) V1192E probably damaging Het
Mdga1 T C 17: 30,150,295 (GRCm39) S106G unknown Het
Mtch2 C T 2: 90,685,274 (GRCm39) R135* probably null Het
Naip1 T C 13: 100,562,828 (GRCm39) N779S possibly damaging Het
Nfia T C 4: 97,951,382 (GRCm39) V403A possibly damaging Het
Npas4 C A 19: 5,038,556 (GRCm39) D121Y probably damaging Het
Rab3gap1 C T 1: 127,837,630 (GRCm39) R231W probably damaging Het
Rangap1 C G 15: 81,610,270 (GRCm39) probably benign Het
Rgs5 T A 1: 169,517,990 (GRCm39) F75I probably benign Het
Rnf19a T C 15: 36,265,452 (GRCm39) D215G possibly damaging Het
Rwdd4a A T 8: 48,000,876 (GRCm39) probably benign Het
Setd5 G A 6: 113,088,469 (GRCm39) R199H probably damaging Het
Spata31e1 T C 13: 49,940,988 (GRCm39) N241D probably benign Het
Spef2 T C 15: 9,599,833 (GRCm39) Q2004R unknown Het
Syne1 T C 10: 5,370,473 (GRCm39) K236E probably benign Het
Tas2r104 A G 6: 131,662,632 (GRCm39) F26L possibly damaging Het
Tenm2 A C 11: 35,918,022 (GRCm39) S1914A possibly damaging Het
Tln2 G T 9: 67,237,834 (GRCm39) Y32* probably null Het
Tnc C T 4: 63,911,296 (GRCm39) R1425H probably damaging Het
Unc13b T C 4: 43,174,724 (GRCm39) C1851R unknown Het
Wapl T A 14: 34,414,159 (GRCm39) D340E probably benign Het
Zfp74 T C 7: 29,634,235 (GRCm39) E491G probably damaging Het
Other mutations in Tbc1d32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Tbc1d32 APN 10 56,031,861 (GRCm39) missense probably damaging 1.00
IGL00535:Tbc1d32 APN 10 56,091,221 (GRCm39) splice site probably benign
IGL00835:Tbc1d32 APN 10 55,965,942 (GRCm39) splice site probably benign
IGL01013:Tbc1d32 APN 10 56,078,055 (GRCm39) splice site probably null
IGL01306:Tbc1d32 APN 10 56,056,620 (GRCm39) missense probably benign 0.14
IGL01452:Tbc1d32 APN 10 56,091,176 (GRCm39) missense possibly damaging 0.71
IGL01668:Tbc1d32 APN 10 55,999,673 (GRCm39) missense probably benign 0.37
IGL02008:Tbc1d32 APN 10 56,027,871 (GRCm39) missense possibly damaging 0.71
IGL02076:Tbc1d32 APN 10 55,964,499 (GRCm39) missense possibly damaging 0.93
IGL02348:Tbc1d32 APN 10 56,100,715 (GRCm39) missense probably benign 0.06
IGL02476:Tbc1d32 APN 10 56,074,638 (GRCm39) missense possibly damaging 0.71
IGL02750:Tbc1d32 APN 10 56,074,587 (GRCm39) missense possibly damaging 0.95
IGL02893:Tbc1d32 APN 10 55,893,799 (GRCm39) missense probably damaging 0.98
ANU23:Tbc1d32 UTSW 10 56,056,620 (GRCm39) missense probably benign 0.14
P0035:Tbc1d32 UTSW 10 56,074,535 (GRCm39) missense probably damaging 1.00
R0118:Tbc1d32 UTSW 10 55,893,701 (GRCm39) missense probably benign 0.02
R0446:Tbc1d32 UTSW 10 56,068,994 (GRCm39) missense possibly damaging 0.93
R0567:Tbc1d32 UTSW 10 56,050,059 (GRCm39) missense possibly damaging 0.71
R0615:Tbc1d32 UTSW 10 56,100,736 (GRCm39) missense probably benign 0.33
R0679:Tbc1d32 UTSW 10 56,056,672 (GRCm39) missense probably damaging 0.99
R0943:Tbc1d32 UTSW 10 56,037,243 (GRCm39) missense probably benign
R1432:Tbc1d32 UTSW 10 55,893,758 (GRCm39) missense probably damaging 0.99
R1454:Tbc1d32 UTSW 10 56,053,575 (GRCm39) splice site probably benign
R1708:Tbc1d32 UTSW 10 56,027,865 (GRCm39) missense possibly damaging 0.84
R1834:Tbc1d32 UTSW 10 55,893,700 (GRCm39) missense probably benign 0.00
R1860:Tbc1d32 UTSW 10 55,999,633 (GRCm39) nonsense probably null
R2208:Tbc1d32 UTSW 10 56,026,888 (GRCm39) critical splice donor site probably null
R3012:Tbc1d32 UTSW 10 56,050,011 (GRCm39) missense probably benign 0.08
R3736:Tbc1d32 UTSW 10 56,005,189 (GRCm39) missense probably damaging 0.99
R4184:Tbc1d32 UTSW 10 56,100,676 (GRCm39) missense probably benign 0.15
R4259:Tbc1d32 UTSW 10 55,925,867 (GRCm39) missense probably damaging 0.97
R4617:Tbc1d32 UTSW 10 56,047,000 (GRCm39) missense possibly damaging 0.92
R4700:Tbc1d32 UTSW 10 56,100,745 (GRCm39) missense probably damaging 0.98
R4794:Tbc1d32 UTSW 10 56,072,932 (GRCm39) missense possibly damaging 0.92
R4879:Tbc1d32 UTSW 10 55,925,125 (GRCm39) splice site probably null
R5031:Tbc1d32 UTSW 10 55,999,627 (GRCm39) missense probably damaging 0.98
R5036:Tbc1d32 UTSW 10 56,071,500 (GRCm39) nonsense probably null
R5276:Tbc1d32 UTSW 10 56,027,914 (GRCm39) missense probably damaging 0.99
R5358:Tbc1d32 UTSW 10 56,047,033 (GRCm39) missense possibly damaging 0.93
R5429:Tbc1d32 UTSW 10 55,904,089 (GRCm39) missense probably damaging 0.99
R5435:Tbc1d32 UTSW 10 55,916,246 (GRCm39) missense probably damaging 0.98
R5451:Tbc1d32 UTSW 10 56,071,571 (GRCm39) missense possibly damaging 0.95
R5607:Tbc1d32 UTSW 10 56,005,246 (GRCm39) missense possibly damaging 0.92
R5642:Tbc1d32 UTSW 10 56,026,973 (GRCm39) missense possibly damaging 0.82
R5732:Tbc1d32 UTSW 10 55,964,489 (GRCm39) missense probably damaging 0.99
R5795:Tbc1d32 UTSW 10 56,091,158 (GRCm39) missense possibly damaging 0.71
R5988:Tbc1d32 UTSW 10 55,964,433 (GRCm39) missense probably damaging 0.98
R6054:Tbc1d32 UTSW 10 56,038,304 (GRCm39) missense possibly damaging 0.95
R6103:Tbc1d32 UTSW 10 56,026,979 (GRCm39) missense probably damaging 0.99
R6277:Tbc1d32 UTSW 10 56,071,525 (GRCm39) missense probably benign
R6422:Tbc1d32 UTSW 10 55,904,157 (GRCm39) nonsense probably null
R6508:Tbc1d32 UTSW 10 56,100,786 (GRCm39) missense probably damaging 0.98
R6859:Tbc1d32 UTSW 10 56,056,626 (GRCm39) missense probably damaging 0.98
R6887:Tbc1d32 UTSW 10 56,027,907 (GRCm39) nonsense probably null
R7012:Tbc1d32 UTSW 10 56,100,820 (GRCm39) missense probably damaging 0.99
R7253:Tbc1d32 UTSW 10 56,074,537 (GRCm39) missense probably benign
R7288:Tbc1d32 UTSW 10 55,927,483 (GRCm39) critical splice donor site probably null
R7599:Tbc1d32 UTSW 10 56,027,929 (GRCm39) missense possibly damaging 0.92
R8338:Tbc1d32 UTSW 10 55,904,173 (GRCm39) missense possibly damaging 0.85
R8814:Tbc1d32 UTSW 10 56,072,688 (GRCm39) missense possibly damaging 0.93
R9018:Tbc1d32 UTSW 10 55,948,693 (GRCm39) missense probably benign 0.02
R9030:Tbc1d32 UTSW 10 56,037,241 (GRCm39) missense possibly damaging 0.92
R9530:Tbc1d32 UTSW 10 56,072,507 (GRCm39) missense probably damaging 0.98
R9616:Tbc1d32 UTSW 10 56,037,246 (GRCm39) missense possibly damaging 0.85
Z1188:Tbc1d32 UTSW 10 56,046,977 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCATCGCTGCAAATATTAC -3'
(R):5'- TCCACCATTATCAATCCTAGTCAGAAG -3'

Sequencing Primer
(F):5'- GCCATCGCTGCAAATATTACTTTTTG -3'
(R):5'- ACATTTTGTGTATTGCCTTTAAGGAG -3'
Posted On 2021-07-15