Incidental Mutation 'R8864:Ggnbp2'
ID 675819
Institutional Source Beutler Lab
Gene Symbol Ggnbp2
Ensembl Gene ENSMUSG00000020530
Gene Name gametogenetin binding protein 2
Synonyms Zfp403, DIF-3, D330017P12Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.861) question?
Stock # R8864 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 84832361-84870817 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 84840076 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 376 (R376C)
Ref Sequence ENSEMBL: ENSMUSP00000127584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018547] [ENSMUST00000100686] [ENSMUST00000108081] [ENSMUST00000154915] [ENSMUST00000168434] [ENSMUST00000170741] [ENSMUST00000172405]
AlphaFold Q5SV77
Predicted Effect probably damaging
Transcript: ENSMUST00000018547
AA Change: R416C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018547
Gene: ENSMUSG00000020530
AA Change: R416C

DomainStartEndE-ValueType
low complexity region 179 185 N/A INTRINSIC
coiled coil region 393 426 N/A INTRINSIC
low complexity region 570 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100686
AA Change: R374C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098252
Gene: ENSMUSG00000020530
AA Change: R374C

DomainStartEndE-ValueType
coiled coil region 351 388 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108081
AA Change: R376C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103716
Gene: ENSMUSG00000020530
AA Change: R376C

DomainStartEndE-ValueType
coiled coil region 353 386 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132098
SMART Domains Protein: ENSMUSP00000129898
Gene: ENSMUSG00000020530

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154915
AA Change: R374C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117482
Gene: ENSMUSG00000020530
AA Change: R374C

DomainStartEndE-ValueType
coiled coil region 351 384 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168434
AA Change: R374C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130013
Gene: ENSMUSG00000020530
AA Change: R374C

DomainStartEndE-ValueType
coiled coil region 351 384 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170741
SMART Domains Protein: ENSMUSP00000128109
Gene: ENSMUSG00000020530

DomainStartEndE-ValueType
low complexity region 99 113 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172405
AA Change: R376C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127584
Gene: ENSMUSG00000020530
AA Change: R376C

DomainStartEndE-ValueType
coiled coil region 353 386 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit lethality throughout fetal growth and development associated with pallor and alterations in placental labyrinth vasculature morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 T A 18: 58,890,425 C297* probably null Het
Adamts3 T C 5: 89,707,122 probably benign Het
Best2 T A 8: 85,009,313 M331L probably benign Het
Cachd1 T A 4: 100,994,829 S1207R probably damaging Het
Cacna2d3 G T 14: 29,333,778 N298K probably damaging Het
Cyp2j12 T C 4: 96,121,513 Y203C probably damaging Het
Dnah8 T C 17: 30,762,642 I3046T possibly damaging Het
Eif3b T C 5: 140,426,532 V252A probably benign Het
Ergic2 A G 6: 148,181,895 V355A probably benign Het
F13a1 C T 13: 36,877,779 G670D probably damaging Het
Gfpt1 T A 6: 87,054,623 D82E probably benign Het
Gm30302 T C 13: 49,787,512 N241D probably benign Het
Grn T C 11: 102,436,385 F191L unknown Het
Ighv1-16 C T 12: 114,665,999 G56D probably benign Het
Jrkl T C 9: 13,244,321 D445G probably benign Het
Loxl3 A G 6: 83,035,758 T93A probably damaging Het
Lrp1b C T 2: 41,112,706 A2094T Het
Lrriq3 T A 3: 155,187,938 D425E probably damaging Het
Majin T C 19: 6,211,620 V55A possibly damaging Het
Mapk8ip3 A T 17: 24,899,518 V1192E probably damaging Het
Mdga1 T C 17: 29,931,321 S106G unknown Het
Mtch2 C T 2: 90,854,930 R135* probably null Het
Naip1 T C 13: 100,426,320 N779S possibly damaging Het
Nfia T C 4: 98,063,145 V403A possibly damaging Het
Npas4 C A 19: 4,988,528 D121Y probably damaging Het
Rab3gap1 C T 1: 127,909,893 R231W probably damaging Het
Rangap1 C G 15: 81,726,069 probably benign Het
Rgs5 T A 1: 169,690,421 F75I probably benign Het
Rnf19a T C 15: 36,265,306 D215G possibly damaging Het
Rwdd4a A T 8: 47,547,841 probably benign Het
Setd5 G A 6: 113,111,508 R199H probably damaging Het
Spef2 T C 15: 9,599,747 Q2004R unknown Het
Syne1 T C 10: 5,420,473 K236E probably benign Het
Tas2r104 A G 6: 131,685,669 F26L possibly damaging Het
Tbc1d32 T A 10: 56,087,559 E954D probably benign Het
Tenm2 A C 11: 36,027,195 S1914A possibly damaging Het
Tln2 G T 9: 67,330,552 Y32* probably null Het
Tnc C T 4: 63,993,059 R1425H probably damaging Het
Unc13b T C 4: 43,174,724 C1851R unknown Het
Wapl T A 14: 34,692,202 D340E probably benign Het
Zfp74 T C 7: 29,934,810 E491G probably damaging Het
Other mutations in Ggnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Ggnbp2 APN 11 84840404 missense possibly damaging 0.49
IGL02095:Ggnbp2 APN 11 84833128 missense probably damaging 1.00
IGL02366:Ggnbp2 APN 11 84841601 missense probably damaging 1.00
IGL02548:Ggnbp2 APN 11 84862286 missense possibly damaging 0.78
R0211:Ggnbp2 UTSW 11 84840313 missense probably damaging 1.00
R0211:Ggnbp2 UTSW 11 84840313 missense probably damaging 1.00
R0375:Ggnbp2 UTSW 11 84836374 nonsense probably null
R0415:Ggnbp2 UTSW 11 84833225 splice site probably benign
R0433:Ggnbp2 UTSW 11 84836420 missense probably damaging 1.00
R0589:Ggnbp2 UTSW 11 84836451 missense probably damaging 1.00
R0970:Ggnbp2 UTSW 11 84862312 missense possibly damaging 0.83
R1413:Ggnbp2 UTSW 11 84833129 missense probably damaging 1.00
R1912:Ggnbp2 UTSW 11 84862296 missense probably benign 0.02
R1997:Ggnbp2 UTSW 11 84860561 missense probably damaging 1.00
R2161:Ggnbp2 UTSW 11 84834433 missense probably benign 0.08
R2220:Ggnbp2 UTSW 11 84836613 missense possibly damaging 0.46
R2879:Ggnbp2 UTSW 11 84832971 splice site probably null
R2941:Ggnbp2 UTSW 11 84841581 missense probably damaging 1.00
R3726:Ggnbp2 UTSW 11 84854094 missense possibly damaging 0.93
R4662:Ggnbp2 UTSW 11 84862246 missense probably damaging 1.00
R4771:Ggnbp2 UTSW 11 84834488 missense probably benign 0.00
R5212:Ggnbp2 UTSW 11 84854021 intron probably benign
R5310:Ggnbp2 UTSW 11 84869968 start codon destroyed probably null 1.00
R5479:Ggnbp2 UTSW 11 84854343 missense probably benign
R5924:Ggnbp2 UTSW 11 84858537 missense possibly damaging 0.61
R6212:Ggnbp2 UTSW 11 84836677 missense possibly damaging 0.94
R6700:Ggnbp2 UTSW 11 84840105 missense probably damaging 1.00
R6931:Ggnbp2 UTSW 11 84833167 missense probably damaging 1.00
R7031:Ggnbp2 UTSW 11 84860641 missense probably damaging 1.00
R7493:Ggnbp2 UTSW 11 84854073 missense probably benign 0.21
R7694:Ggnbp2 UTSW 11 84860713 missense possibly damaging 0.94
R7761:Ggnbp2 UTSW 11 84839977 splice site probably null
R8257:Ggnbp2 UTSW 11 84837989 critical splice acceptor site probably null
R8355:Ggnbp2 UTSW 11 84837989 critical splice acceptor site probably null
R8419:Ggnbp2 UTSW 11 84837989 critical splice acceptor site probably null
R8511:Ggnbp2 UTSW 11 84837989 critical splice acceptor site probably null
R8512:Ggnbp2 UTSW 11 84837989 critical splice acceptor site probably null
R8532:Ggnbp2 UTSW 11 84837989 critical splice acceptor site probably null
R8534:Ggnbp2 UTSW 11 84837989 critical splice acceptor site probably null
R8551:Ggnbp2 UTSW 11 84841525 nonsense probably null
R8695:Ggnbp2 UTSW 11 84869941 missense possibly damaging 0.81
R8705:Ggnbp2 UTSW 11 84862306 missense possibly damaging 0.82
R9055:Ggnbp2 UTSW 11 84841622 missense probably damaging 1.00
R9142:Ggnbp2 UTSW 11 84840060 missense possibly damaging 0.96
R9324:Ggnbp2 UTSW 11 84834348 missense probably damaging 1.00
R9523:Ggnbp2 UTSW 11 84854362 missense probably benign 0.07
R9578:Ggnbp2 UTSW 11 84854163 missense probably benign 0.22
Z1187:Ggnbp2 UTSW 11 84836652 missense probably benign 0.04
Z1188:Ggnbp2 UTSW 11 84836652 missense probably benign 0.04
Z1189:Ggnbp2 UTSW 11 84836652 missense probably benign 0.04
Z1190:Ggnbp2 UTSW 11 84836652 missense probably benign 0.04
Z1192:Ggnbp2 UTSW 11 84836652 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAACACGGCTTACCCATGATTTTG -3'
(R):5'- AAGTGGATCGCTTCTGACTG -3'

Sequencing Primer
(F):5'- TACCCATGATTTTGGAGGAAAAGCC -3'
(R):5'- GGGGTTTATTAATCATGGGCCTAATC -3'
Posted On 2021-07-15