Mutagenetix > Incidental Mutation

Incidental Mutation 'R8864:Grn'

675820

Institutional Source

Beutler Lab

Gene Symbol

Grn

Ensembl Gene

ENSMUSG00000034708

Gene Name

granulin

Synonyms

progranulin, epithelin, acrogranulin, PC cell-derived growth factor, Pgrn

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.246) question?

Stock #

R8864 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102430315-102437048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102436385 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 191 (F191L)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049057] [ENSMUST00000049460] [ENSMUST00000125819] [ENSMUST00000129997]

AlphaFold

P28798

Predicted Effect

probably benign
Transcript: ENSMUST00000049057

SMART Domains

Protein: ENSMUSP00000038486
Gene: ENSMUSG00000034685

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:UPF0560	41	820	N/A	PFAM

Predicted Effect

silent
Transcript: ENSMUST00000049460

SMART Domains

Protein: ENSMUSP00000046340
Gene: ENSMUSG00000034708

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
GRAN	74	125	1.32e-22	SMART
GRAN	138	190	7.38e-26	SMART
GRAN	220	272	5.76e-28	SMART
GRAN	295	346	1.19e-29	SMART
GRAN	377	427	1.84e-26	SMART
GRAN	455	506	7.1e-28	SMART
GRAN	530	581	1.48e-25	SMART

Predicted Effect

silent
Transcript: ENSMUST00000125819

SMART Domains

Protein: ENSMUSP00000134948
Gene: ENSMUSG00000034708

Domain	Start	End	E-Value	Type
GRAN	42	72	5.03e-4	SMART
GRAN	100	151	7.1e-28	SMART
GRAN	175	226	1.48e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129997

SMART Domains

Protein: ENSMUSP00000135739
Gene: ENSMUSG00000034708

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
GRAN	61	112	1.32e-22	SMART
GRAN	125	177	7.38e-26	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000177428
AA Change: F191L

SMART Domains

Protein: ENSMUSP00000134893
Gene: ENSMUSG00000034708
AA Change: F191L

Domain	Start	End	E-Value	Type
GRAN	1	49	8.68e-23	SMART
GRAN	77	128	7.1e-28	SMART
GRAN	152	180	3.98e-2	SMART
low complexity region	244	259	N/A	INTRINSIC
low complexity region	309	324	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Granulins are a family of secreted, glycosylated peptides that are cleaved from a single precursor protein with 7.5 repeats of a highly conserved 12-cysteine granulin/epithelin motif. The 88 kDa precursor protein, progranulin, is also called proepithelin and PC cell-derived growth factor. Cleavage of the signal peptide produces mature granulin which can be further cleaved into a variety of active, 6 kDa peptides. These smaller cleavage products are named granulin A, granulin B, granulin C, etc. Epithelins 1 and 2 are synonymous with granulins A and B, respectively. Both the peptides and intact granulin protein regulate cell growth. However, different members of the granulin protein family may act as inhibitors, stimulators, or have dual actions on cell growth. Granulin family members are important in normal development, wound healing, and tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some knock-out alleles display enhanced macrophage functions. Mice homozygous for another knock-out allele display reproductive and behavioral abnormalities. Mice homozygous for a third null allele display premature death and increased cellular aging. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	T	A	18: 58,890,425	C297*	probably null	Het
Adamts3	T	C	5: 89,707,122		probably benign	Het
Best2	T	A	8: 85,009,313	M331L	probably benign	Het
Cachd1	T	A	4: 100,994,829	S1207R	probably damaging	Het
Cacna2d3	G	T	14: 29,333,778	N298K	probably damaging	Het
Cyp2j12	T	C	4: 96,121,513	Y203C	probably damaging	Het
Dnah8	T	C	17: 30,762,642	I3046T	possibly damaging	Het
Eif3b	T	C	5: 140,426,532	V252A	probably benign	Het
Ergic2	A	G	6: 148,181,895	V355A	probably benign	Het
F13a1	C	T	13: 36,877,779	G670D	probably damaging	Het
Gfpt1	T	A	6: 87,054,623	D82E	probably benign	Het
Ggnbp2	G	A	11: 84,840,076	R376C	probably damaging	Het
Gm30302	T	C	13: 49,787,512	N241D	probably benign	Het
Ighv1-16	C	T	12: 114,665,999	G56D	probably benign	Het
Jrkl	T	C	9: 13,244,321	D445G	probably benign	Het
Loxl3	A	G	6: 83,035,758	T93A	probably damaging	Het
Lrp1b	C	T	2: 41,112,706	A2094T		Het
Lrriq3	T	A	3: 155,187,938	D425E	probably damaging	Het
Majin	T	C	19: 6,211,620	V55A	possibly damaging	Het
Mapk8ip3	A	T	17: 24,899,518	V1192E	probably damaging	Het
Mdga1	T	C	17: 29,931,321	S106G	unknown	Het
Mtch2	C	T	2: 90,854,930	R135*	probably null	Het
Naip1	T	C	13: 100,426,320	N779S	possibly damaging	Het
Nfia	T	C	4: 98,063,145	V403A	possibly damaging	Het
Npas4	C	A	19: 4,988,528	D121Y	probably damaging	Het
Rab3gap1	C	T	1: 127,909,893	R231W	probably damaging	Het
Rangap1	C	G	15: 81,726,069		probably benign	Het
Rgs5	T	A	1: 169,690,421	F75I	probably benign	Het
Rnf19a	T	C	15: 36,265,306	D215G	possibly damaging	Het
Rwdd4a	A	T	8: 47,547,841		probably benign	Het
Setd5	G	A	6: 113,111,508	R199H	probably damaging	Het
Spef2	T	C	15: 9,599,747	Q2004R	unknown	Het
Syne1	T	C	10: 5,420,473	K236E	probably benign	Het
Tas2r104	A	G	6: 131,685,669	F26L	possibly damaging	Het
Tbc1d32	T	A	10: 56,087,559	E954D	probably benign	Het
Tenm2	A	C	11: 36,027,195	S1914A	possibly damaging	Het
Tln2	G	T	9: 67,330,552	Y32*	probably null	Het
Tnc	C	T	4: 63,993,059	R1425H	probably damaging	Het
Unc13b	T	C	4: 43,174,724	C1851R	unknown	Het
Wapl	T	A	14: 34,692,202	D340E	probably benign	Het
Zfp74	T	C	7: 29,934,810	E491G	probably damaging	Het

Other mutations in Grn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02422:Grn	APN	11	102436258	splice site	probably benign
IGL02456:Grn	APN	11	102436104	missense	probably benign	0.01
PIT4434001:Grn	UTSW	11	102435940	missense	possibly damaging	0.88
R0395:Grn	UTSW	11	102436223	missense	probably benign	0.03
R0784:Grn	UTSW	11	102434502	missense	possibly damaging	0.74
R1037:Grn	UTSW	11	102433070	missense	possibly damaging	0.94
R1753:Grn	UTSW	11	102433267	missense	probably damaging	1.00
R1905:Grn	UTSW	11	102436450	missense	probably damaging	1.00
R3110:Grn	UTSW	11	102433243	missense	probably benign	0.07
R3111:Grn	UTSW	11	102433243	missense	probably benign	0.07
R3112:Grn	UTSW	11	102433243	missense	probably benign	0.07
R3974:Grn	UTSW	11	102436339	missense	probably damaging	1.00
R4908:Grn	UTSW	11	102436518	unclassified	probably benign
R4989:Grn	UTSW	11	102430554	unclassified	probably benign
R5012:Grn	UTSW	11	102430554	unclassified	probably benign
R5013:Grn	UTSW	11	102430554	unclassified	probably benign
R5108:Grn	UTSW	11	102434402	missense	probably benign	0.10
R5133:Grn	UTSW	11	102430554	unclassified	probably benign
R5134:Grn	UTSW	11	102430554	unclassified	probably benign
R5162:Grn	UTSW	11	102430554	unclassified	probably benign
R5182:Grn	UTSW	11	102430554	unclassified	probably benign
R5183:Grn	UTSW	11	102430554	unclassified	probably benign
R5308:Grn	UTSW	11	102436192	missense	possibly damaging	0.96
R5350:Grn	UTSW	11	102436244	missense	possibly damaging	0.50
R5786:Grn	UTSW	11	102434043	nonsense	probably null
R6383:Grn	UTSW	11	102436795	unclassified	probably benign
R7679:Grn	UTSW	11	102433069	missense	probably benign	0.01
R7741:Grn	UTSW	11	102435734	missense	probably damaging	1.00
R8312:Grn	UTSW	11	102436247	missense	probably damaging	0.98
R8677:Grn	UTSW	11	102433567	missense	possibly damaging	0.94
R8682:Grn	UTSW	11	102434820	missense	probably benign	0.04
R9001:Grn	UTSW	11	102436671	missense

Predicted Primers

PCR Primer
(F):5'- TTGTAAAGACAGTGCAGGAGTC -3'
(R):5'- CATGGTGATAGGGTGACTCAGG -3'

Sequencing Primer
(F):5'- ACAGTGCAGGAGTCTGGGC -3'
(R):5'- CTCAGGATGAGTAGGCCGG -3'

Posted On

2021-07-15