Mutagenetix > Incidental Mutation

Incidental Mutation 'R8864:Naip1'

675824

Institutional Source

Beutler Lab

Gene Symbol

Naip1

Ensembl Gene

ENSMUSG00000021640

Gene Name

NLR family, apoptosis inhibitory protein 1

Synonyms

Birc1a, D13Lsd1, Naip

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8864 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

100407764-100452869 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100426320 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 779 (N779S)

Ref Sequence

ENSEMBL: ENSMUSP00000022142 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022142] [ENSMUST00000221727] [ENSMUST00000221943] [ENSMUST00000222155]

AlphaFold

Q9QWK5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022142
AA Change: N779S

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000022142
Gene: ENSMUSG00000021640
AA Change: N779S

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
BIR	58	129	1.18e-20	SMART
BIR	157	229	1.06e-36	SMART
BIR	276	347	7.82e-26	SMART
AAA	462	603	1.14e-2	SMART
low complexity region	908	919	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000221727

Predicted Effect

probably benign
Transcript: ENSMUST00000221943

Predicted Effect

possibly damaging
Transcript: ENSMUST00000222155
AA Change: N779S

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (41/41)

MGI Phenotype

PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	T	A	18: 58,890,425	C297*	probably null	Het
Adamts3	T	C	5: 89,707,122		probably benign	Het
Best2	T	A	8: 85,009,313	M331L	probably benign	Het
Cachd1	T	A	4: 100,994,829	S1207R	probably damaging	Het
Cacna2d3	G	T	14: 29,333,778	N298K	probably damaging	Het
Cyp2j12	T	C	4: 96,121,513	Y203C	probably damaging	Het
Dnah8	T	C	17: 30,762,642	I3046T	possibly damaging	Het
Eif3b	T	C	5: 140,426,532	V252A	probably benign	Het
Ergic2	A	G	6: 148,181,895	V355A	probably benign	Het
F13a1	C	T	13: 36,877,779	G670D	probably damaging	Het
Gfpt1	T	A	6: 87,054,623	D82E	probably benign	Het
Ggnbp2	G	A	11: 84,840,076	R376C	probably damaging	Het
Gm30302	T	C	13: 49,787,512	N241D	probably benign	Het
Grn	T	C	11: 102,436,385	F191L	unknown	Het
Ighv1-16	C	T	12: 114,665,999	G56D	probably benign	Het
Jrkl	T	C	9: 13,244,321	D445G	probably benign	Het
Loxl3	A	G	6: 83,035,758	T93A	probably damaging	Het
Lrp1b	C	T	2: 41,112,706	A2094T		Het
Lrriq3	T	A	3: 155,187,938	D425E	probably damaging	Het
Majin	T	C	19: 6,211,620	V55A	possibly damaging	Het
Mapk8ip3	A	T	17: 24,899,518	V1192E	probably damaging	Het
Mdga1	T	C	17: 29,931,321	S106G	unknown	Het
Mtch2	C	T	2: 90,854,930	R135*	probably null	Het
Nfia	T	C	4: 98,063,145	V403A	possibly damaging	Het
Npas4	C	A	19: 4,988,528	D121Y	probably damaging	Het
Rab3gap1	C	T	1: 127,909,893	R231W	probably damaging	Het
Rangap1	C	G	15: 81,726,069		probably benign	Het
Rgs5	T	A	1: 169,690,421	F75I	probably benign	Het
Rnf19a	T	C	15: 36,265,306	D215G	possibly damaging	Het
Rwdd4a	A	T	8: 47,547,841		probably benign	Het
Setd5	G	A	6: 113,111,508	R199H	probably damaging	Het
Spef2	T	C	15: 9,599,747	Q2004R	unknown	Het
Syne1	T	C	10: 5,420,473	K236E	probably benign	Het
Tas2r104	A	G	6: 131,685,669	F26L	possibly damaging	Het
Tbc1d32	T	A	10: 56,087,559	E954D	probably benign	Het
Tenm2	A	C	11: 36,027,195	S1914A	possibly damaging	Het
Tln2	G	T	9: 67,330,552	Y32*	probably null	Het
Tnc	C	T	4: 63,993,059	R1425H	probably damaging	Het
Unc13b	T	C	4: 43,174,724	C1851R	unknown	Het
Wapl	T	A	14: 34,692,202	D340E	probably benign	Het
Zfp74	T	C	7: 29,934,810	E491G	probably damaging	Het

Other mutations in Naip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01115:Naip1	APN	13	100443720	critical splice acceptor site	probably null
IGL01145:Naip1	APN	13	100409121	missense	probably benign	0.00
IGL01356:Naip1	APN	13	100423214	missense	probably damaging	0.99
IGL01414:Naip1	APN	13	100409173	critical splice acceptor site	probably null
IGL01505:Naip1	APN	13	100425933	missense	probably damaging	1.00
IGL01573:Naip1	APN	13	100427382	missense	probably benign	0.03
IGL01931:Naip1	APN	13	100409032	nonsense	probably null
IGL02043:Naip1	APN	13	100426796	missense	probably benign	0.03
IGL02097:Naip1	APN	13	100425588	missense	probably benign	0.03
IGL02331:Naip1	APN	13	100426796	missense	probably benign	0.03
IGL02627:Naip1	APN	13	100425648	missense	possibly damaging	0.68
IGL02675:Naip1	APN	13	100409118	missense	probably benign
IGL02801:Naip1	APN	13	100444368	missense	probably damaging	1.00
IGL02851:Naip1	APN	13	100433262	missense	probably damaging	1.00
IGL03038:Naip1	APN	13	100437333	nonsense	probably null
IGL03399:Naip1	APN	13	100408918	missense	probably damaging	1.00
FR4340:Naip1	UTSW	13	100423076	missense	probably benign
FR4342:Naip1	UTSW	13	100425471	missense	probably benign	0.00
R0051:Naip1	UTSW	13	100411001	missense	probably damaging	0.96
R0095:Naip1	UTSW	13	100423083	missense	probably benign	0.24
R0147:Naip1	UTSW	13	100426910	missense	possibly damaging	0.67
R0375:Naip1	UTSW	13	100409148	missense	probably benign	0.21
R0442:Naip1	UTSW	13	100444516	missense	probably benign	0.00
R0455:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R0491:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R0614:Naip1	UTSW	13	100444200	missense	probably benign	0.00
R0785:Naip1	UTSW	13	100423076	missense	probably benign
R0785:Naip1	UTSW	13	100423085	missense	probably benign	0.00
R0787:Naip1	UTSW	13	100426096	missense	probably benign	0.22
R1081:Naip1	UTSW	13	100423070	missense	probably benign	0.21
R1177:Naip1	UTSW	13	100427064	missense	possibly damaging	0.91
R1476:Naip1	UTSW	13	100426870	missense	probably benign	0.35
R1672:Naip1	UTSW	13	100423149	missense	probably benign	0.00
R1809:Naip1	UTSW	13	100426239	missense	probably benign
R2057:Naip1	UTSW	13	100425573	missense	probably damaging	0.96
R2182:Naip1	UTSW	13	100413680	missense	probably benign	0.01
R2395:Naip1	UTSW	13	100423106	missense	possibly damaging	0.83
R2518:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R3033:Naip1	UTSW	13	100432458	missense	probably benign	0.01
R3122:Naip1	UTSW	13	100408995	missense	probably damaging	1.00
R3439:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R4167:Naip1	UTSW	13	100444286	missense	probably benign	0.04
R4179:Naip1	UTSW	13	100426176	missense	probably damaging	0.99
R4212:Naip1	UTSW	13	100426875	splice site	probably null
R4639:Naip1	UTSW	13	100444283	missense	probably benign	0.31
R4674:Naip1	UTSW	13	100444174	missense	probably damaging	1.00
R4736:Naip1	UTSW	13	100444526	missense	possibly damaging	0.47
R4740:Naip1	UTSW	13	100444526	missense	possibly damaging	0.47
R4778:Naip1	UTSW	13	100426648	missense	probably damaging	1.00
R4806:Naip1	UTSW	13	100425621	missense	probably benign	0.00
R4855:Naip1	UTSW	13	100423220	splice site	probably null
R5740:Naip1	UTSW	13	100432501	critical splice acceptor site	probably null
R5797:Naip1	UTSW	13	100444526	missense	possibly damaging	0.47
R5806:Naip1	UTSW	13	100444735	start codon destroyed	probably null	1.00
R5895:Naip1	UTSW	13	100423128	missense	probably benign	0.00
R5896:Naip1	UTSW	13	100423128	missense	probably benign	0.00
R6023:Naip1	UTSW	13	100426186	missense	probably benign	0.00
R6109:Naip1	UTSW	13	100427182	missense	probably damaging	1.00
R6117:Naip1	UTSW	13	100444737	start codon destroyed	probably damaging	0.99
R6133:Naip1	UTSW	13	100444643	missense	probably benign	0.10
R6241:Naip1	UTSW	13	100425661	missense	probably damaging	0.99
R6335:Naip1	UTSW	13	100426552	missense	probably damaging	1.00
R6404:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R6475:Naip1	UTSW	13	100409088	missense	probably damaging	1.00
R6508:Naip1	UTSW	13	100436465	missense	probably damaging	1.00
R6580:Naip1	UTSW	13	100444649	missense	probably damaging	0.99
R6600:Naip1	UTSW	13	100423070	missense	probably benign	0.21
R6600:Naip1	UTSW	13	100423158	missense	probably benign	0.00
R6603:Naip1	UTSW	13	100423070	missense	probably benign	0.21
R6603:Naip1	UTSW	13	100423158	missense	probably benign	0.00
R6633:Naip1	UTSW	13	100423076	missense	probably benign
R6633:Naip1	UTSW	13	100423085	missense	probably benign	0.00
R6720:Naip1	UTSW	13	100423077	missense	probably benign	0.00
R6805:Naip1	UTSW	13	100427341	missense	probably benign	0.04
R7043:Naip1	UTSW	13	100426914	missense	probably damaging	1.00
R7615:Naip1	UTSW	13	100425776	missense	probably benign	0.00
R7797:Naip1	UTSW	13	100444478	missense	probably damaging	1.00
R7820:Naip1	UTSW	13	100423070	missense	probably benign	0.21
R7842:Naip1	UTSW	13	100426998	missense	probably damaging	1.00
R8117:Naip1	UTSW	13	100427001	missense	possibly damaging	0.67
R8132:Naip1	UTSW	13	100437375	missense	possibly damaging	0.84
R8177:Naip1	UTSW	13	100427403	missense	probably benign	0.00
R8203:Naip1	UTSW	13	100425820	missense	probably benign	0.02
R8283:Naip1	UTSW	13	100427187	missense	probably damaging	1.00
R8319:Naip1	UTSW	13	100429213	missense	probably benign	0.13
R8377:Naip1	UTSW	13	100425866	missense	possibly damaging	0.53
R8871:Naip1	UTSW	13	100443638	missense	probably damaging	1.00
R8987:Naip1	UTSW	13	100426926	missense	probably damaging	1.00
R9079:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R9275:Naip1	UTSW	13	100426176	missense	probably damaging	0.99
R9354:Naip1	UTSW	13	100427486	missense	probably benign	0.31
R9524:Naip1	UTSW	13	100426593	missense	probably benign	0.06
R9617:Naip1	UTSW	13	100433313	missense	probably benign	0.01
R9776:Naip1	UTSW	13	100423076	missense	probably benign
R9802:Naip1	UTSW	13	100426205	missense	probably benign
RF007:Naip1	UTSW	13	100426134	missense	probably benign	0.03
X0066:Naip1	UTSW	13	100437322	missense	probably damaging	1.00
Y4335:Naip1	UTSW	13	100425522	missense	probably benign	0.00
Y4336:Naip1	UTSW	13	100425522	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TATTCAGGAGATAACAGCCACAGTTC -3'
(R):5'- AAGAGCTCACCACCTGCTTG -3'

Sequencing Primer
(F):5'- AGTCCCTTCATTATTCGGGAAG -3'
(R):5'- AGCTCACCACCTGCTTGATGAG -3'

Posted On

2021-07-15