Mutagenetix > Incidental Mutation

Incidental Mutation 'R8864:Wapl'

675826

Institutional Source

Beutler Lab

Gene Symbol

Wapl

Ensembl Gene

ENSMUSG00000041408

Gene Name

WAPL cohesin release factor

Synonyms

A530089A20Rik, Wapal

MMRRC Submission

068680-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8864 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34673928-34747983 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34692202 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 340 (D340E)

Ref Sequence

ENSEMBL: ENSMUSP00000040232 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]

AlphaFold

Q65Z40

Predicted Effect

probably benign
Transcript: ENSMUST00000048263
AA Change: D340E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: D340E

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	645	1009	6.5e-153	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090027
AA Change: D340E

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: D340E

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	639	1003	2.6e-153	PFAM
low complexity region	1012	1027	N/A	INTRINSIC
low complexity region	1095	1106	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169910
AA Change: D340E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: D340E

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	647	1008	3.5e-120	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	T	A	18: 58,890,425	C297*	probably null	Het
Adamts3	T	C	5: 89,707,122		probably benign	Het
Best2	T	A	8: 85,009,313	M331L	probably benign	Het
Cachd1	T	A	4: 100,994,829	S1207R	probably damaging	Het
Cacna2d3	G	T	14: 29,333,778	N298K	probably damaging	Het
Cyp2j12	T	C	4: 96,121,513	Y203C	probably damaging	Het
Dnah8	T	C	17: 30,762,642	I3046T	possibly damaging	Het
Eif3b	T	C	5: 140,426,532	V252A	probably benign	Het
Ergic2	A	G	6: 148,181,895	V355A	probably benign	Het
F13a1	C	T	13: 36,877,779	G670D	probably damaging	Het
Gfpt1	T	A	6: 87,054,623	D82E	probably benign	Het
Ggnbp2	G	A	11: 84,840,076	R376C	probably damaging	Het
Gm30302	T	C	13: 49,787,512	N241D	probably benign	Het
Grn	T	C	11: 102,436,385	F191L	unknown	Het
Ighv1-16	C	T	12: 114,665,999	G56D	probably benign	Het
Jrkl	T	C	9: 13,244,321	D445G	probably benign	Het
Loxl3	A	G	6: 83,035,758	T93A	probably damaging	Het
Lrp1b	C	T	2: 41,112,706	A2094T		Het
Lrriq3	T	A	3: 155,187,938	D425E	probably damaging	Het
Majin	T	C	19: 6,211,620	V55A	possibly damaging	Het
Mapk8ip3	A	T	17: 24,899,518	V1192E	probably damaging	Het
Mdga1	T	C	17: 29,931,321	S106G	unknown	Het
Mtch2	C	T	2: 90,854,930	R135*	probably null	Het
Naip1	T	C	13: 100,426,320	N779S	possibly damaging	Het
Nfia	T	C	4: 98,063,145	V403A	possibly damaging	Het
Npas4	C	A	19: 4,988,528	D121Y	probably damaging	Het
Rab3gap1	C	T	1: 127,909,893	R231W	probably damaging	Het
Rangap1	C	G	15: 81,726,069		probably benign	Het
Rgs5	T	A	1: 169,690,421	F75I	probably benign	Het
Rnf19a	T	C	15: 36,265,306	D215G	possibly damaging	Het
Rwdd4a	A	T	8: 47,547,841		probably benign	Het
Setd5	G	A	6: 113,111,508	R199H	probably damaging	Het
Spef2	T	C	15: 9,599,747	Q2004R	unknown	Het
Syne1	T	C	10: 5,420,473	K236E	probably benign	Het
Tas2r104	A	G	6: 131,685,669	F26L	possibly damaging	Het
Tbc1d32	T	A	10: 56,087,559	E954D	probably benign	Het
Tenm2	A	C	11: 36,027,195	S1914A	possibly damaging	Het
Tln2	G	T	9: 67,330,552	Y32*	probably null	Het
Tnc	C	T	4: 63,993,059	R1425H	probably damaging	Het
Unc13b	T	C	4: 43,174,724	C1851R	unknown	Het
Zfp74	T	C	7: 29,934,810	E491G	probably damaging	Het

Other mutations in Wapl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Wapl	APN	14	34692636	missense	probably benign	0.00
IGL00539:Wapl	APN	14	34695008	missense	probably damaging	1.00
IGL00846:Wapl	APN	14	34692744	splice site	probably benign
IGL01070:Wapl	APN	14	34745622	unclassified	probably benign
IGL01516:Wapl	APN	14	34692081	missense	probably damaging	1.00
IGL02021:Wapl	APN	14	34722336	missense	probably benign
IGL02209:Wapl	APN	14	34677261	missense	possibly damaging	0.46
IGL02309:Wapl	APN	14	34744863	missense	probably damaging	0.98
IGL02471:Wapl	APN	14	34691920	missense	possibly damaging	0.68
IGL02965:Wapl	APN	14	34739224	intron	probably benign
IGL03076:Wapl	APN	14	34692089	missense	probably benign	0.26
IGL03197:Wapl	APN	14	34745631	missense	possibly damaging	0.77
Mcclintock	UTSW	14	34730662	critical splice donor site	probably null
Tatum	UTSW	14	34729195	missense	probably damaging	1.00
R0045:Wapl	UTSW	14	34733794	missense	probably benign	0.18
R0278:Wapl	UTSW	14	34692612	missense	possibly damaging	0.68
R0335:Wapl	UTSW	14	34692324	missense	probably damaging	0.99
R1018:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R1295:Wapl	UTSW	14	34724769	missense	probably damaging	1.00
R1553:Wapl	UTSW	14	34729190	missense	probably damaging	1.00
R1868:Wapl	UTSW	14	34692458	missense	probably benign	0.00
R1909:Wapl	UTSW	14	34691912	missense	probably damaging	1.00
R2698:Wapl	UTSW	14	34691777	missense	probably benign
R2990:Wapl	UTSW	14	34736708	missense	probably damaging	0.98
R3121:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3122:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3147:Wapl	UTSW	14	34725149	missense	probably damaging	1.00
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3733:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3878:Wapl	UTSW	14	34692147	missense	probably damaging	1.00
R4034:Wapl	UTSW	14	34737914	missense	possibly damaging	0.92
R4934:Wapl	UTSW	14	34692095	missense	probably benign	0.11
R5079:Wapl	UTSW	14	34724757	missense	probably damaging	1.00
R5104:Wapl	UTSW	14	34692059	nonsense	probably null
R5113:Wapl	UTSW	14	34724754	missense	probably damaging	1.00
R5121:Wapl	UTSW	14	34677162	missense	probably benign	0.01
R5222:Wapl	UTSW	14	34736685	nonsense	probably null
R5299:Wapl	UTSW	14	34733808	critical splice donor site	probably null
R5387:Wapl	UTSW	14	34677295	missense	probably benign	0.00
R5541:Wapl	UTSW	14	34730662	critical splice donor site	probably null
R5618:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R5802:Wapl	UTSW	14	34692320	missense	probably damaging	1.00
R6029:Wapl	UTSW	14	34739247	missense	possibly damaging	0.94
R6292:Wapl	UTSW	14	34729195	missense	probably damaging	1.00
R6482:Wapl	UTSW	14	34692692	missense	probably benign	0.01
R6487:Wapl	UTSW	14	34692292	missense	probably damaging	1.00
R6925:Wapl	UTSW	14	34677363	missense	probably benign	0.31
R6937:Wapl	UTSW	14	34722354	missense	probably benign	0.01
R7080:Wapl	UTSW	14	34692356	missense	probably benign	0.03
R7203:Wapl	UTSW	14	34736691	missense	probably benign
R7944:Wapl	UTSW	14	34677148	missense	probably benign	0.00
R7945:Wapl	UTSW	14	34677148	missense	probably benign	0.00
R7969:Wapl	UTSW	14	34730647	missense	probably damaging	1.00
R8038:Wapl	UTSW	14	34691682	missense	probably benign
R8053:Wapl	UTSW	14	34692321	missense	probably damaging	1.00
R8688:Wapl	UTSW	14	34692592	missense	possibly damaging	0.94
R8988:Wapl	UTSW	14	34729182	missense	probably damaging	1.00
R9072:Wapl	UTSW	14	34677460	missense	possibly damaging	0.81
R9197:Wapl	UTSW	14	34722287	missense	probably damaging	1.00
R9259:Wapl	UTSW	14	34741095	missense	probably benign	0.00
R9545:Wapl	UTSW	14	34677093	missense	probably damaging	1.00
R9613:Wapl	UTSW	14	34731563	missense	probably benign	0.29
R9624:Wapl	UTSW	14	34692106	missense	possibly damaging	0.89
Z1177:Wapl	UTSW	14	34745690	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- CTCTTTTGGAGATGAAAGACGAG -3'
(R):5'- TAAATCTGCAGGAGTGGATGC -3'

Sequencing Primer
(F):5'- TCGGATTGGAGGATTGGAAAATC -3'
(R):5'- TGGATGCGGTGAACTCATCCATAC -3'

Posted On

2021-07-15