Incidental Mutation 'R8864:Rnf19a'
ID 675828
Institutional Source Beutler Lab
Gene Symbol Rnf19a
Ensembl Gene ENSMUSG00000022280
Gene Name ring finger protein 19A
Synonyms XY body protein, Dorfin, Rnf19, XYbp
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.569) question?
Stock # R8864 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 36239933-36283147 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36265306 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 215 (D215G)
Ref Sequence ENSEMBL: ENSMUSP00000022890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022890] [ENSMUST00000228358]
AlphaFold P50636
Predicted Effect possibly damaging
Transcript: ENSMUST00000022890
AA Change: D215G

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022890
Gene: ENSMUSG00000022280
AA Change: D215G

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
RING 132 179 5.56e-3 SMART
IBR 199 264 1.5e-24 SMART
IBR 283 347 1.87e-2 SMART
transmembrane domain 373 395 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 664 682 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 775 787 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000228358
AA Change: D215G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.4881 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ring between ring fingers (RBR) protein family, and the encoded protein contains two RING-finger motifs and an in between RING fingers motif. This protein is an E3 ubiquitin ligase that is localized to Lewy bodies, and ubiquitylates synphilin-1, which is an interacting protein of alpha synuclein in neurons. The encoded protein may be involved in amyotrophic lateral sclerosis and Parkinson's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 T A 18: 58,890,425 C297* probably null Het
Adamts3 T C 5: 89,707,122 probably benign Het
Best2 T A 8: 85,009,313 M331L probably benign Het
Cachd1 T A 4: 100,994,829 S1207R probably damaging Het
Cacna2d3 G T 14: 29,333,778 N298K probably damaging Het
Cyp2j12 T C 4: 96,121,513 Y203C probably damaging Het
Dnah8 T C 17: 30,762,642 I3046T possibly damaging Het
Eif3b T C 5: 140,426,532 V252A probably benign Het
Ergic2 A G 6: 148,181,895 V355A probably benign Het
F13a1 C T 13: 36,877,779 G670D probably damaging Het
Gfpt1 T A 6: 87,054,623 D82E probably benign Het
Ggnbp2 G A 11: 84,840,076 R376C probably damaging Het
Gm30302 T C 13: 49,787,512 N241D probably benign Het
Grn T C 11: 102,436,385 F191L unknown Het
Ighv1-16 C T 12: 114,665,999 G56D probably benign Het
Jrkl T C 9: 13,244,321 D445G probably benign Het
Loxl3 A G 6: 83,035,758 T93A probably damaging Het
Lrp1b C T 2: 41,112,706 A2094T Het
Lrriq3 T A 3: 155,187,938 D425E probably damaging Het
Majin T C 19: 6,211,620 V55A possibly damaging Het
Mapk8ip3 A T 17: 24,899,518 V1192E probably damaging Het
Mdga1 T C 17: 29,931,321 S106G unknown Het
Mtch2 C T 2: 90,854,930 R135* probably null Het
Naip1 T C 13: 100,426,320 N779S possibly damaging Het
Nfia T C 4: 98,063,145 V403A possibly damaging Het
Npas4 C A 19: 4,988,528 D121Y probably damaging Het
Rab3gap1 C T 1: 127,909,893 R231W probably damaging Het
Rangap1 C G 15: 81,726,069 probably benign Het
Rgs5 T A 1: 169,690,421 F75I probably benign Het
Rwdd4a A T 8: 47,547,841 probably benign Het
Setd5 G A 6: 113,111,508 R199H probably damaging Het
Spef2 T C 15: 9,599,747 Q2004R unknown Het
Syne1 T C 10: 5,420,473 K236E probably benign Het
Tas2r104 A G 6: 131,685,669 F26L possibly damaging Het
Tbc1d32 T A 10: 56,087,559 E954D probably benign Het
Tenm2 A C 11: 36,027,195 S1914A possibly damaging Het
Tln2 G T 9: 67,330,552 Y32* probably null Het
Tnc C T 4: 63,993,059 R1425H probably damaging Het
Unc13b T C 4: 43,174,724 C1851R unknown Het
Wapl T A 14: 34,692,202 D340E probably benign Het
Zfp74 T C 7: 29,934,810 E491G probably damaging Het
Other mutations in Rnf19a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rnf19a APN 15 36265802 missense probably damaging 0.98
Cycle UTSW 15 36253304 intron probably benign
Tolkien UTSW 15 36265306 missense possibly damaging 0.80
Wagner UTSW 15 36244196 missense probably benign 0.05
R0245:Rnf19a UTSW 15 36253032 missense probably damaging 1.00
R0583:Rnf19a UTSW 15 36253005 missense probably damaging 1.00
R1295:Rnf19a UTSW 15 36244101 nonsense probably null
R1528:Rnf19a UTSW 15 36265655 missense possibly damaging 0.75
R1710:Rnf19a UTSW 15 36244207 missense probably damaging 1.00
R1835:Rnf19a UTSW 15 36265925 missense probably benign
R2005:Rnf19a UTSW 15 36241770 missense possibly damaging 0.52
R2110:Rnf19a UTSW 15 36254519 missense possibly damaging 0.79
R3118:Rnf19a UTSW 15 36241899 nonsense probably null
R3776:Rnf19a UTSW 15 36265912 missense probably benign 0.03
R4005:Rnf19a UTSW 15 36245628 missense probably damaging 0.98
R5184:Rnf19a UTSW 15 36244196 missense probably benign 0.05
R5297:Rnf19a UTSW 15 36247778 missense probably damaging 1.00
R5386:Rnf19a UTSW 15 36242039 missense probably benign 0.01
R5647:Rnf19a UTSW 15 36265963 start gained probably benign
R6451:Rnf19a UTSW 15 36253059 missense possibly damaging 0.64
R7003:Rnf19a UTSW 15 36254504 nonsense probably null
R7304:Rnf19a UTSW 15 36254452 missense probably damaging 0.98
R7893:Rnf19a UTSW 15 36241668 missense possibly damaging 0.95
R8808:Rnf19a UTSW 15 36241875 missense probably benign 0.00
R8940:Rnf19a UTSW 15 36260138 missense probably damaging 1.00
R9063:Rnf19a UTSW 15 36265469 nonsense probably null
R9093:Rnf19a UTSW 15 36253304 intron probably benign
R9135:Rnf19a UTSW 15 36253164 critical splice acceptor site probably null
R9525:Rnf19a UTSW 15 36247229 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTCTTCACAAAATGCAAGTG -3'
(R):5'- GATTGCTTACGACAATACCTAAGG -3'

Sequencing Primer
(F):5'- TGCAAGTGAGAATTTAACAGAGAC -3'
(R):5'- CGACAATACCTAAGGATAGAAATCTC -3'
Posted On 2021-07-15