Mutagenetix > Incidental Mutation

Incidental Mutation 'R8864:Mdga1'

675830

Institutional Source

Beutler Lab

Gene Symbol

Mdga1

Ensembl Gene

ENSMUSG00000043557

Gene Name

MAM domain containing glycosylphosphatidylinositol anchor 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.276) question?

Stock #

R8864 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

29827956-29970087 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 29931321 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 106 (S106G)

Ref Sequence

ENSEMBL: ENSMUSP00000130395 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167190]

AlphaFold

Q0PMG2

Predicted Effect

unknown
Transcript: ENSMUST00000167190
AA Change: S106G

SMART Domains

Protein: ENSMUSP00000130395
Gene: ENSMUSG00000043557
AA Change: S106G

Domain	Start	End	E-Value	Type
low complexity region	236	246	N/A	INTRINSIC
low complexity region	251	265	N/A	INTRINSIC
IGc2	325	389	1.62e-12	SMART
IG	416	510	3.2e-2	SMART
IGc2	527	589	6.25e-14	SMART
IGc2	622	696	3.54e-4	SMART
IGc2	728	795	6.55e-8	SMART
IGc2	825	897	9.49e-5	SMART

Meta Mutation Damage Score

0.0852

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylphosphatidylinositol (GPI)-anchored cell surface glycoprotein that is expressed predominantly in the developing nervous system. In addition to possessing several cell adhesion molecule-like domains, the mature protein has six Ig-like domains, a single fibronectin type III domain, a MAM domain and a C-terminal GPI-anchoring site. Studies in other mammals suggest this protein plays a role in cell adhesion, migration, and axon guidance and, in the developing brain, neuronal migration. In humans, this gene is associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuronal migration during corticogenesis that is resolved by P7 [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	T	A	18: 58,890,425	C297*	probably null	Het
Adamts3	T	C	5: 89,707,122		probably benign	Het
Best2	T	A	8: 85,009,313	M331L	probably benign	Het
Cachd1	T	A	4: 100,994,829	S1207R	probably damaging	Het
Cacna2d3	G	T	14: 29,333,778	N298K	probably damaging	Het
Cyp2j12	T	C	4: 96,121,513	Y203C	probably damaging	Het
Dnah8	T	C	17: 30,762,642	I3046T	possibly damaging	Het
Eif3b	T	C	5: 140,426,532	V252A	probably benign	Het
Ergic2	A	G	6: 148,181,895	V355A	probably benign	Het
F13a1	C	T	13: 36,877,779	G670D	probably damaging	Het
Gfpt1	T	A	6: 87,054,623	D82E	probably benign	Het
Ggnbp2	G	A	11: 84,840,076	R376C	probably damaging	Het
Gm30302	T	C	13: 49,787,512	N241D	probably benign	Het
Grn	T	C	11: 102,436,385	F191L	unknown	Het
Ighv1-16	C	T	12: 114,665,999	G56D	probably benign	Het
Jrkl	T	C	9: 13,244,321	D445G	probably benign	Het
Loxl3	A	G	6: 83,035,758	T93A	probably damaging	Het
Lrp1b	C	T	2: 41,112,706	A2094T		Het
Lrriq3	T	A	3: 155,187,938	D425E	probably damaging	Het
Majin	T	C	19: 6,211,620	V55A	possibly damaging	Het
Mapk8ip3	A	T	17: 24,899,518	V1192E	probably damaging	Het
Mtch2	C	T	2: 90,854,930	R135*	probably null	Het
Naip1	T	C	13: 100,426,320	N779S	possibly damaging	Het
Nfia	T	C	4: 98,063,145	V403A	possibly damaging	Het
Npas4	C	A	19: 4,988,528	D121Y	probably damaging	Het
Rab3gap1	C	T	1: 127,909,893	R231W	probably damaging	Het
Rangap1	C	G	15: 81,726,069		probably benign	Het
Rgs5	T	A	1: 169,690,421	F75I	probably benign	Het
Rnf19a	T	C	15: 36,265,306	D215G	possibly damaging	Het
Rwdd4a	A	T	8: 47,547,841		probably benign	Het
Setd5	G	A	6: 113,111,508	R199H	probably damaging	Het
Spef2	T	C	15: 9,599,747	Q2004R	unknown	Het
Syne1	T	C	10: 5,420,473	K236E	probably benign	Het
Tas2r104	A	G	6: 131,685,669	F26L	possibly damaging	Het
Tbc1d32	T	A	10: 56,087,559	E954D	probably benign	Het
Tenm2	A	C	11: 36,027,195	S1914A	possibly damaging	Het
Tln2	G	T	9: 67,330,552	Y32*	probably null	Het
Tnc	C	T	4: 63,993,059	R1425H	probably damaging	Het
Unc13b	T	C	4: 43,174,724	C1851R	unknown	Het
Wapl	T	A	14: 34,692,202	D340E	probably benign	Het
Zfp74	T	C	7: 29,934,810	E491G	probably damaging	Het

Other mutations in Mdga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01576:Mdga1	APN	17	29843127	missense	possibly damaging	0.50
IGL01637:Mdga1	APN	17	29839871	missense	probably damaging	1.00
IGL02130:Mdga1	APN	17	29857669	missense	possibly damaging	0.96
IGL02596:Mdga1	APN	17	29832405	splice site	probably benign
IGL03258:Mdga1	APN	17	29839913	missense	probably damaging	1.00
R0184:Mdga1	UTSW	17	29852442	missense	probably damaging	1.00
R0366:Mdga1	UTSW	17	29857708	missense	possibly damaging	0.85
R1017:Mdga1	UTSW	17	29850548	missense	probably damaging	0.98
R1520:Mdga1	UTSW	17	29846519	missense	probably benign	0.12
R1545:Mdga1	UTSW	17	29842902	missense	probably damaging	1.00
R1549:Mdga1	UTSW	17	29837998	missense	probably damaging	1.00
R1671:Mdga1	UTSW	17	29850629	missense	probably damaging	1.00
R1875:Mdga1	UTSW	17	29852607	missense	probably damaging	1.00
R1893:Mdga1	UTSW	17	29849226	missense	probably damaging	1.00
R1958:Mdga1	UTSW	17	29840888	missense	probably damaging	1.00
R1983:Mdga1	UTSW	17	29850605	missense	probably damaging	1.00
R2014:Mdga1	UTSW	17	29849313	missense	probably damaging	1.00
R2894:Mdga1	UTSW	17	29852504	missense	probably damaging	1.00
R2964:Mdga1	UTSW	17	29852468	missense	probably damaging	1.00
R3813:Mdga1	UTSW	17	29838479	missense	probably damaging	1.00
R3938:Mdga1	UTSW	17	29857622	missense	probably damaging	1.00
R3982:Mdga1	UTSW	17	29931264	missense	unknown
R4063:Mdga1	UTSW	17	29838031	missense	probably damaging	1.00
R4157:Mdga1	UTSW	17	29833343	missense	probably benign	0.32
R4183:Mdga1	UTSW	17	29969990	missense	unknown
R4392:Mdga1	UTSW	17	29850656	missense	probably damaging	1.00
R4393:Mdga1	UTSW	17	29850517	missense	probably damaging	1.00
R4396:Mdga1	UTSW	17	29850517	missense	probably damaging	1.00
R4806:Mdga1	UTSW	17	29842154	missense	probably benign	0.20
R4829:Mdga1	UTSW	17	29846369	missense	possibly damaging	0.91
R4923:Mdga1	UTSW	17	29838078	missense	probably damaging	0.99
R4932:Mdga1	UTSW	17	29857606	missense	probably damaging	1.00
R5015:Mdga1	UTSW	17	29839873	missense	possibly damaging	0.71
R5076:Mdga1	UTSW	17	29850554	missense	possibly damaging	0.93
R5141:Mdga1	UTSW	17	29852493	missense	probably benign	0.43
R5180:Mdga1	UTSW	17	29857736	splice site	probably benign
R5590:Mdga1	UTSW	17	29839867	missense	probably damaging	1.00
R5747:Mdga1	UTSW	17	29850551	missense	probably benign	0.11
R5748:Mdga1	UTSW	17	29850551	missense	probably benign	0.11
R6207:Mdga1	UTSW	17	29838517	missense	probably damaging	1.00
R6826:Mdga1	UTSW	17	29970026	missense	unknown
R6831:Mdga1	UTSW	17	29887516	nonsense	probably null
R7114:Mdga1	UTSW	17	29842842	splice site	probably null
R7147:Mdga1	UTSW	17	29846521	nonsense	probably null
R7273:Mdga1	UTSW	17	29969938	missense	unknown
R7413:Mdga1	UTSW	17	29850673	missense	probably damaging	1.00
R7637:Mdga1	UTSW	17	29832379	missense	probably benign	0.00
R7797:Mdga1	UTSW	17	29842840	splice site	probably null
R7812:Mdga1	UTSW	17	29843141	missense	probably benign	0.02
R7838:Mdga1	UTSW	17	29839822	missense	probably benign	0.10
R8463:Mdga1	UTSW	17	29849729	missense	probably damaging	1.00
R8697:Mdga1	UTSW	17	29846641	missense	probably damaging	0.97
R8699:Mdga1	UTSW	17	29842374	missense	possibly damaging	0.87
R8945:Mdga1	UTSW	17	29839985	splice site	probably benign
R9150:Mdga1	UTSW	17	29838446	missense	probably damaging	0.98
R9157:Mdga1	UTSW	17	29838517	missense	probably damaging	1.00
R9294:Mdga1	UTSW	17	29839897	missense	probably damaging	1.00
R9301:Mdga1	UTSW	17	29850538	missense	probably benign	0.31
R9367:Mdga1	UTSW	17	29832308	makesense	probably null
R9567:Mdga1	UTSW	17	29857595	missense	probably damaging	1.00
R9665:Mdga1	UTSW	17	29833017	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGTGTATGGCCTAGCATCTCC -3'
(R):5'- TGAAGTCCTGTCGATATCTGTC -3'

Sequencing Primer
(F):5'- AGCATCTCCCCATTTCAGGTTAGAAG -3'
(R):5'- AAGTCCTGTCGATATCTGTCTTGGC -3'

Posted On

2021-07-15