Incidental Mutation 'R8864:Adamts19'
ID 675832
Institutional Source Beutler Lab
Gene Symbol Adamts19
Ensembl Gene ENSMUSG00000053441
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 19
Synonyms D230034E10Rik
MMRRC Submission 068680-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8864 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 58969739-59187132 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 59023497 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 297 (C297*)
Ref Sequence ENSEMBL: ENSMUSP00000050535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052907]
AlphaFold P59509
Predicted Effect probably null
Transcript: ENSMUST00000052907
AA Change: C297*
SMART Domains Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: C297*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 57 84 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
Pfam:Pep_M12B_propep 131 276 1.6e-21 PFAM
Pfam:Reprolysin_5 326 523 1.7e-13 PFAM
Pfam:Reprolysin_4 328 544 2e-10 PFAM
Pfam:Reprolysin 328 548 9e-22 PFAM
Pfam:Reprolysin_2 346 537 1.6e-9 PFAM
Pfam:Reprolysin_3 350 496 3.4e-12 PFAM
low complexity region 551 562 N/A INTRINSIC
TSP1 639 689 5.68e-9 SMART
Pfam:ADAM_spacer1 793 903 1.1e-31 PFAM
TSP1 922 980 4.95e-2 SMART
TSP1 982 1040 4.95e-2 SMART
TSP1 1042 1086 1.62e-4 SMART
TSP1 1093 1147 1.03e-6 SMART
Pfam:PLAC 1167 1199 4.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,854,981 (GRCm39) probably benign Het
Best2 T A 8: 85,735,942 (GRCm39) M331L probably benign Het
Cachd1 T A 4: 100,852,026 (GRCm39) S1207R probably damaging Het
Cacna2d3 G T 14: 29,055,735 (GRCm39) N298K probably damaging Het
Cyp2j12 T C 4: 96,009,750 (GRCm39) Y203C probably damaging Het
Dnah8 T C 17: 30,981,616 (GRCm39) I3046T possibly damaging Het
Eif3b T C 5: 140,412,287 (GRCm39) V252A probably benign Het
Ergic2 A G 6: 148,083,393 (GRCm39) V355A probably benign Het
F13a1 C T 13: 37,061,753 (GRCm39) G670D probably damaging Het
Gfpt1 T A 6: 87,031,605 (GRCm39) D82E probably benign Het
Ggnbp2 G A 11: 84,730,902 (GRCm39) R376C probably damaging Het
Grn T C 11: 102,327,211 (GRCm39) F191L unknown Het
Ighv1-16 C T 12: 114,629,619 (GRCm39) G56D probably benign Het
Jrkl T C 9: 13,244,326 (GRCm39) D445G probably benign Het
Loxl3 A G 6: 83,012,739 (GRCm39) T93A probably damaging Het
Lrp1b C T 2: 41,002,718 (GRCm39) A2094T Het
Lrriq3 T A 3: 154,893,575 (GRCm39) D425E probably damaging Het
Majin T C 19: 6,261,650 (GRCm39) V55A possibly damaging Het
Mapk8ip3 A T 17: 25,118,492 (GRCm39) V1192E probably damaging Het
Mdga1 T C 17: 30,150,295 (GRCm39) S106G unknown Het
Mtch2 C T 2: 90,685,274 (GRCm39) R135* probably null Het
Naip1 T C 13: 100,562,828 (GRCm39) N779S possibly damaging Het
Nfia T C 4: 97,951,382 (GRCm39) V403A possibly damaging Het
Npas4 C A 19: 5,038,556 (GRCm39) D121Y probably damaging Het
Rab3gap1 C T 1: 127,837,630 (GRCm39) R231W probably damaging Het
Rangap1 C G 15: 81,610,270 (GRCm39) probably benign Het
Rgs5 T A 1: 169,517,990 (GRCm39) F75I probably benign Het
Rnf19a T C 15: 36,265,452 (GRCm39) D215G possibly damaging Het
Rwdd4a A T 8: 48,000,876 (GRCm39) probably benign Het
Setd5 G A 6: 113,088,469 (GRCm39) R199H probably damaging Het
Spata31e1 T C 13: 49,940,988 (GRCm39) N241D probably benign Het
Spef2 T C 15: 9,599,833 (GRCm39) Q2004R unknown Het
Syne1 T C 10: 5,370,473 (GRCm39) K236E probably benign Het
Tas2r104 A G 6: 131,662,632 (GRCm39) F26L possibly damaging Het
Tbc1d32 T A 10: 55,963,655 (GRCm39) E954D probably benign Het
Tenm2 A C 11: 35,918,022 (GRCm39) S1914A possibly damaging Het
Tln2 G T 9: 67,237,834 (GRCm39) Y32* probably null Het
Tnc C T 4: 63,911,296 (GRCm39) R1425H probably damaging Het
Unc13b T C 4: 43,174,724 (GRCm39) C1851R unknown Het
Wapl T A 14: 34,414,159 (GRCm39) D340E probably benign Het
Zfp74 T C 7: 29,634,235 (GRCm39) E491G probably damaging Het
Other mutations in Adamts19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Adamts19 APN 18 59,157,537 (GRCm39) missense probably damaging 1.00
IGL00331:Adamts19 APN 18 59,140,397 (GRCm39) splice site probably benign
IGL00970:Adamts19 APN 18 59,144,149 (GRCm39) missense possibly damaging 0.82
IGL01328:Adamts19 APN 18 59,181,954 (GRCm39) missense possibly damaging 0.89
IGL01385:Adamts19 APN 18 59,105,851 (GRCm39) missense probably damaging 0.98
IGL01529:Adamts19 APN 18 59,096,535 (GRCm39) missense probably damaging 0.99
IGL01535:Adamts19 APN 18 59,101,891 (GRCm39) missense probably benign 0.00
IGL01557:Adamts19 APN 18 59,101,792 (GRCm39) splice site probably null
IGL01705:Adamts19 APN 18 59,166,038 (GRCm39) missense possibly damaging 0.91
IGL01803:Adamts19 APN 18 59,085,541 (GRCm39) missense probably damaging 1.00
IGL02116:Adamts19 APN 18 58,970,571 (GRCm39) missense probably benign
IGL02131:Adamts19 APN 18 59,185,732 (GRCm39) missense probably damaging 1.00
IGL02312:Adamts19 APN 18 59,060,369 (GRCm39) missense probably damaging 1.00
IGL02755:Adamts19 APN 18 59,103,005 (GRCm39) missense probably benign 0.25
IGL02866:Adamts19 APN 18 59,181,914 (GRCm39) missense possibly damaging 0.80
IGL02964:Adamts19 APN 18 59,122,037 (GRCm39) missense probably damaging 1.00
IGL02982:Adamts19 APN 18 59,157,590 (GRCm39) missense probably damaging 1.00
IGL03040:Adamts19 APN 18 59,036,080 (GRCm39) missense probably benign 0.05
R0081:Adamts19 UTSW 18 59,036,137 (GRCm39) critical splice donor site probably null
R0194:Adamts19 UTSW 18 59,144,220 (GRCm39) missense probably null 1.00
R0195:Adamts19 UTSW 18 59,102,942 (GRCm39) splice site probably benign
R0541:Adamts19 UTSW 18 59,060,372 (GRCm39) critical splice donor site probably null
R0659:Adamts19 UTSW 18 59,140,565 (GRCm39) splice site probably benign
R0967:Adamts19 UTSW 18 59,105,812 (GRCm39) nonsense probably null
R1512:Adamts19 UTSW 18 59,181,917 (GRCm39) missense possibly damaging 0.89
R1536:Adamts19 UTSW 18 59,185,687 (GRCm39) missense probably damaging 1.00
R1582:Adamts19 UTSW 18 59,103,013 (GRCm39) missense probably damaging 0.98
R1629:Adamts19 UTSW 18 59,087,691 (GRCm39) missense probably damaging 0.97
R1653:Adamts19 UTSW 18 59,023,365 (GRCm39) missense probably benign 0.00
R1718:Adamts19 UTSW 18 59,105,897 (GRCm39) missense probably damaging 1.00
R1733:Adamts19 UTSW 18 59,165,001 (GRCm39) missense probably damaging 1.00
R1753:Adamts19 UTSW 18 59,140,444 (GRCm39) missense possibly damaging 0.78
R1776:Adamts19 UTSW 18 59,087,692 (GRCm39) missense probably damaging 1.00
R1905:Adamts19 UTSW 18 59,166,017 (GRCm39) missense possibly damaging 0.92
R1958:Adamts19 UTSW 18 59,103,078 (GRCm39) missense probably benign 0.09
R1994:Adamts19 UTSW 18 59,105,903 (GRCm39) critical splice donor site probably null
R2177:Adamts19 UTSW 18 59,087,626 (GRCm39) missense possibly damaging 0.66
R3730:Adamts19 UTSW 18 59,033,982 (GRCm39) missense probably damaging 1.00
R4342:Adamts19 UTSW 18 59,075,572 (GRCm39) missense probably damaging 1.00
R4772:Adamts19 UTSW 18 58,970,848 (GRCm39) missense possibly damaging 0.85
R4822:Adamts19 UTSW 18 59,023,356 (GRCm39) missense probably damaging 1.00
R4891:Adamts19 UTSW 18 59,166,072 (GRCm39) missense probably damaging 1.00
R5112:Adamts19 UTSW 18 59,164,876 (GRCm39) nonsense probably null
R5116:Adamts19 UTSW 18 59,036,066 (GRCm39) missense possibly damaging 0.52
R5205:Adamts19 UTSW 18 59,101,880 (GRCm39) missense probably damaging 1.00
R5765:Adamts19 UTSW 18 59,185,654 (GRCm39) missense probably damaging 1.00
R5781:Adamts19 UTSW 18 58,971,040 (GRCm39) missense possibly damaging 0.59
R5792:Adamts19 UTSW 18 58,970,584 (GRCm39) missense possibly damaging 0.49
R6082:Adamts19 UTSW 18 59,101,846 (GRCm39) missense probably benign 0.18
R6088:Adamts19 UTSW 18 59,035,174 (GRCm39) missense probably damaging 1.00
R7060:Adamts19 UTSW 18 58,970,712 (GRCm39) nonsense probably null
R7251:Adamts19 UTSW 18 58,970,974 (GRCm39) missense probably damaging 1.00
R7295:Adamts19 UTSW 18 58,970,955 (GRCm39) missense probably damaging 1.00
R7974:Adamts19 UTSW 18 59,144,094 (GRCm39) missense possibly damaging 0.72
R7991:Adamts19 UTSW 18 59,185,726 (GRCm39) missense probably damaging 1.00
R8129:Adamts19 UTSW 18 59,140,559 (GRCm39) critical splice donor site probably null
R8297:Adamts19 UTSW 18 58,970,920 (GRCm39) missense probably damaging 1.00
R8336:Adamts19 UTSW 18 59,140,444 (GRCm39) missense possibly damaging 0.78
R8358:Adamts19 UTSW 18 59,181,881 (GRCm39) missense probably damaging 1.00
R9051:Adamts19 UTSW 18 59,034,048 (GRCm39) missense probably damaging 1.00
R9253:Adamts19 UTSW 18 59,103,013 (GRCm39) missense probably damaging 0.98
R9423:Adamts19 UTSW 18 59,023,427 (GRCm39) missense possibly damaging 0.89
R9610:Adamts19 UTSW 18 59,023,399 (GRCm39) missense probably benign 0.26
R9611:Adamts19 UTSW 18 59,023,399 (GRCm39) missense probably benign 0.26
R9686:Adamts19 UTSW 18 58,971,093 (GRCm39) missense probably benign 0.00
R9697:Adamts19 UTSW 18 59,101,834 (GRCm39) missense probably damaging 0.99
R9747:Adamts19 UTSW 18 59,023,487 (GRCm39) missense possibly damaging 0.69
Z1177:Adamts19 UTSW 18 59,023,446 (GRCm39) missense possibly damaging 0.47
Z1177:Adamts19 UTSW 18 58,971,147 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCAAAGAGTTCGTGTGC -3'
(R):5'- TCCTGTGCTGGCCTTTGAAG -3'

Sequencing Primer
(F):5'- CAAAGAGTTCGTGTGCACATTCG -3'
(R):5'- TGCTGGCCTTTGAAGAATTTTAG -3'
Posted On 2021-07-15