Incidental Mutation 'R8864:Npas4'
ID675833
Institutional Source Beutler Lab
Gene Symbol Npas4
Ensembl Gene ENSMUSG00000045903
Gene Nameneuronal PAS domain protein 4
SynonymsNpas4, LE-PAS, Nxf
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.616) question?
Stock #R8864 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location4984355-4989971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4988528 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 121 (D121Y)
Ref Sequence ENSEMBL: ENSMUSP00000062992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056129]
Predicted Effect probably damaging
Transcript: ENSMUST00000056129
AA Change: D121Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062992
Gene: ENSMUSG00000045903
AA Change: D121Y

DomainStartEndE-ValueType
Blast:HLH 6 56 1e-26 BLAST
low complexity region 57 69 N/A INTRINSIC
PAS 72 140 1.88e-6 SMART
low complexity region 197 211 N/A INTRINSIC
PAS 213 273 5.66e-1 SMART
internal_repeat_1 394 473 1.35e-6 PROSPERO
internal_repeat_1 467 556 1.35e-6 PROSPERO
low complexity region 657 676 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NXF is a member of the basic helix-loop-helix-PER (MIM 602260)-ARNT (MIM 126110)-SIM (see SIM2; MIM 600892) (bHLH-PAS) class of transcriptional regulators, which are involved in a wide range of physiologic and developmental events (Ooe et al., 2004 [PubMed 14701734]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity, seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 T A 18: 58,890,425 C297* probably null Het
Best2 T A 8: 85,009,313 M331L probably benign Het
Cachd1 T A 4: 100,994,829 S1207R probably damaging Het
Cacna2d3 G T 14: 29,333,778 N298K probably damaging Het
Cyp2j12 T C 4: 96,121,513 Y203C probably damaging Het
Dnah8 T C 17: 30,762,642 I3046T possibly damaging Het
Eif3b T C 5: 140,426,532 V252A probably benign Het
Ergic2 A G 6: 148,181,895 V355A probably benign Het
F13a1 C T 13: 36,877,779 G670D probably damaging Het
Gfpt1 T A 6: 87,054,623 D82E probably benign Het
Ggnbp2 G A 11: 84,840,076 R376C probably damaging Het
Gm30302 T C 13: 49,787,512 N241D probably benign Het
Grn T C 11: 102,436,385 F191L unknown Het
Ighv1-16 C T 12: 114,665,999 G56D probably benign Het
Jrkl T C 9: 13,244,321 D445G probably benign Het
Loxl3 A G 6: 83,035,758 T93A probably damaging Het
Lrp1b C T 2: 41,112,706 A2094T Het
Lrriq3 T A 3: 155,187,938 D425E probably damaging Het
Majin T C 19: 6,211,620 V55A possibly damaging Het
Mapk8ip3 A T 17: 24,899,518 V1192E probably damaging Het
Mdga1 T C 17: 29,931,321 S106G unknown Het
Mtch2 C T 2: 90,854,930 R135* probably null Het
Naip1 T C 13: 100,426,320 N779S possibly damaging Het
Nfia T C 4: 98,063,145 V403A possibly damaging Het
Rab3gap1 C T 1: 127,909,893 R231W probably damaging Het
Rgs5 T A 1: 169,690,421 F75I probably benign Het
Rnf19a T C 15: 36,265,306 D215G possibly damaging Het
Setd5 G A 6: 113,111,508 R199H probably damaging Het
Spef2 T C 15: 9,599,747 Q2004R unknown Het
Syne1 T C 10: 5,420,473 K236E probably benign Het
Tas2r104 A G 6: 131,685,669 F26L possibly damaging Het
Tbc1d32 T A 10: 56,087,559 E954D probably benign Het
Tenm2 A C 11: 36,027,195 S1914A possibly damaging Het
Tln2 G T 9: 67,330,552 Y32* probably null Het
Tnc C T 4: 63,993,059 R1425H probably damaging Het
Unc13b T C 4: 43,174,724 C1851R unknown Het
Wapl T A 14: 34,692,202 D340E probably benign Het
Zfp74 T C 7: 29,934,810 E491G probably damaging Het
Other mutations in Npas4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Npas4 APN 19 4987327 missense possibly damaging 0.93
IGL01865:Npas4 APN 19 4985791 nonsense probably null
IGL02746:Npas4 APN 19 4986667 missense probably damaging 0.99
IGL03061:Npas4 APN 19 4986337 missense probably damaging 1.00
IGL03340:Npas4 APN 19 4985066 utr 3 prime probably benign
R0879:Npas4 UTSW 19 4986916 missense probably benign
R0920:Npas4 UTSW 19 4986316 nonsense probably null
R1751:Npas4 UTSW 19 4988183 missense probably benign 0.05
R1767:Npas4 UTSW 19 4988183 missense probably benign 0.05
R2066:Npas4 UTSW 19 4987414 missense probably damaging 0.99
R2201:Npas4 UTSW 19 4987364 missense probably benign 0.06
R3973:Npas4 UTSW 19 4986551 missense probably benign
R4117:Npas4 UTSW 19 4987363 missense probably damaging 0.99
R4846:Npas4 UTSW 19 4986777 missense probably benign 0.34
R5007:Npas4 UTSW 19 4989656 missense possibly damaging 0.61
R6155:Npas4 UTSW 19 4986870 missense probably damaging 1.00
R6255:Npas4 UTSW 19 4986375 missense probably damaging 1.00
R6488:Npas4 UTSW 19 4985983 missense probably damaging 1.00
R8427:Npas4 UTSW 19 4986080 missense probably benign
Z1177:Npas4 UTSW 19 4986242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGGTGTTGAATCGACAAC -3'
(R):5'- AGCATCTGGGCCACTCTATG -3'

Sequencing Primer
(F):5'- TCGACAACGGAAAAGGCGATC -3'
(R):5'- GGTGAGTACTAAAAGTCCTTGCATC -3'
Posted On2021-07-15