Incidental Mutation 'R8865:Col4a3'
ID675836
Institutional Source Beutler Lab
Gene Symbol Col4a3
Ensembl Gene ENSMUSG00000079465
Gene Namecollagen, type IV, alpha 3
Synonymsalpha3(IV), tumstatin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8865 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location82586921-82722059 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 82669762 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113457] [ENSMUST00000113457]
Predicted Effect probably null
Transcript: ENSMUST00000113457
SMART Domains Protein: ENSMUSP00000109084
Gene: ENSMUSG00000079465

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 41 102 9.6e-11 PFAM
Pfam:Collagen 97 164 3.6e-11 PFAM
Pfam:Collagen 164 223 3.6e-9 PFAM
low complexity region 233 243 N/A INTRINSIC
Pfam:Collagen 284 344 2.4e-10 PFAM
low complexity region 368 393 N/A INTRINSIC
Pfam:Collagen 415 477 5e-10 PFAM
Pfam:Collagen 481 545 1e-9 PFAM
low complexity region 550 585 N/A INTRINSIC
Pfam:Collagen 588 653 8.9e-9 PFAM
Pfam:Collagen 682 744 1.1e-8 PFAM
Pfam:Collagen 743 807 6.9e-10 PFAM
Pfam:Collagen 786 847 1.5e-8 PFAM
Pfam:Collagen 845 904 1.5e-10 PFAM
Pfam:Collagen 887 946 4.1e-10 PFAM
Pfam:Collagen 948 1006 8.1e-11 PFAM
Pfam:Collagen 997 1061 2.8e-10 PFAM
Pfam:Collagen 1057 1120 2.5e-10 PFAM
Pfam:Collagen 1114 1176 1.7e-9 PFAM
Pfam:Collagen 1174 1233 1.1e-9 PFAM
Pfam:Collagen 1232 1295 6.9e-9 PFAM
low complexity region 1326 1347 N/A INTRINSIC
Pfam:Collagen 1377 1439 4.9e-11 PFAM
C4 1444 1553 3.77e-70 SMART
C4 1554 1667 3.28e-70 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113457
SMART Domains Protein: ENSMUSP00000109084
Gene: ENSMUSG00000079465

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 41 102 9.6e-11 PFAM
Pfam:Collagen 97 164 3.6e-11 PFAM
Pfam:Collagen 164 223 3.6e-9 PFAM
low complexity region 233 243 N/A INTRINSIC
Pfam:Collagen 284 344 2.4e-10 PFAM
low complexity region 368 393 N/A INTRINSIC
Pfam:Collagen 415 477 5e-10 PFAM
Pfam:Collagen 481 545 1e-9 PFAM
low complexity region 550 585 N/A INTRINSIC
Pfam:Collagen 588 653 8.9e-9 PFAM
Pfam:Collagen 682 744 1.1e-8 PFAM
Pfam:Collagen 743 807 6.9e-10 PFAM
Pfam:Collagen 786 847 1.5e-8 PFAM
Pfam:Collagen 845 904 1.5e-10 PFAM
Pfam:Collagen 887 946 4.1e-10 PFAM
Pfam:Collagen 948 1006 8.1e-11 PFAM
Pfam:Collagen 997 1061 2.8e-10 PFAM
Pfam:Collagen 1057 1120 2.5e-10 PFAM
Pfam:Collagen 1114 1176 1.7e-9 PFAM
Pfam:Collagen 1174 1233 1.1e-9 PFAM
Pfam:Collagen 1232 1295 6.9e-9 PFAM
low complexity region 1326 1347 N/A INTRINSIC
Pfam:Collagen 1377 1439 4.9e-11 PFAM
C4 1444 1553 3.77e-70 SMART
C4 1554 1667 3.28e-70 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit renal pathology including reduced glomerular filtration, impaired glomerular integrity, and glomerulonephrosis, resulting in uremia, proteinuria, and high mortality in young adults. Auditory thresholds aremildly increased across all test frequencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T A 11: 50,781,744 Y606* probably null Het
Adgrb1 A G 15: 74,543,658 I696V possibly damaging Het
Ass1 A G 2: 31,520,395 Q406R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccdc148 T C 2: 58,829,820 K409R possibly damaging Het
Ccnl1 A T 3: 65,946,848 S451T probably benign Het
Cep192 T C 18: 67,834,632 V729A probably benign Het
Chd6 G A 2: 161,021,069 A444V probably benign Het
Chl1 A G 6: 103,708,861 K898E probably damaging Het
Chrng T C 1: 87,207,497 V154A probably damaging Het
Cog1 T G 11: 113,658,498 M799R probably benign Het
Coro6 C A 11: 77,469,091 T366K probably damaging Het
Cwh43 G A 5: 73,441,359 M640I probably benign Het
Cyp2c55 A G 19: 39,031,434 E272G probably benign Het
Cyp4f39 A G 17: 32,483,297 Y256C probably damaging Het
Dbx2 G A 15: 95,632,400 R229* probably null Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
F3 T A 3: 121,729,411 V90E probably damaging Het
Fam171a1 A G 2: 3,225,903 K691R probably damaging Het
Foxp2 C T 6: 15,415,094 A609V unknown Het
Hemgn A T 4: 46,396,682 S185T possibly damaging Het
Hk1 C T 10: 62,315,515 D33N probably benign Het
Igfbp1 T A 11: 7,201,929 V244D probably damaging Het
Insr A T 8: 3,161,358 D1160E probably damaging Het
Irs1 A T 1: 82,288,109 Y795* probably null Het
Krtap28-10 T C 1: 83,042,087 K111E unknown Het
Lbx1 T G 19: 45,235,166 D21A probably benign Het
Map6 G T 7: 99,268,985 A322S probably benign Het
Mat1a T C 14: 41,121,831 Y336H probably damaging Het
Mcf2l A G 8: 12,880,003 I8V probably benign Het
Med12l T C 3: 59,071,882 V276A probably benign Het
Mettl17 A G 14: 51,884,851 probably benign Het
Mllt1 T C 17: 56,900,295 D183G possibly damaging Het
Msmb T A 14: 32,150,260 C69* probably null Het
Mterf1a A G 5: 3,891,425 S148P probably damaging Het
Mybl2 A G 2: 163,080,733 I583V probably benign Het
Nbr1 T A 11: 101,564,694 D91E probably benign Het
Notch3 A G 17: 32,122,116 Y2221H probably benign Het
Npat C A 9: 53,570,640 T1216N probably benign Het
Olfr1082 C A 2: 86,594,400 V143F possibly damaging Het
Olfr127 T C 17: 37,904,224 L226P probably damaging Het
Olfr137 T A 17: 38,304,981 H160L probably damaging Het
Pawr T A 10: 108,382,742 Y170N probably damaging Het
Pde12 T C 14: 26,669,125 D143G possibly damaging Het
Phactr2 A G 10: 13,253,732 I264T probably benign Het
Pip5k1b A G 19: 24,397,058 L53P probably damaging Het
Pknox1 T C 17: 31,599,546 I251T probably benign Het
Ppil2 T C 16: 17,097,405 N113S probably benign Het
Pramel4 G C 4: 144,068,482 G483R probably damaging Het
Prdm10 T C 9: 31,327,397 L195P probably damaging Het
Prss16 A T 13: 22,003,005 L465Q possibly damaging Het
Psg25 G T 7: 18,529,594 H101Q possibly damaging Het
Pstpip2 A G 18: 77,846,408 D55G possibly damaging Het
Rfc1 A T 5: 65,278,792 D636E possibly damaging Het
Scarf2 G T 16: 17,803,110 C214F probably damaging Het
Sirt4 T C 5: 115,482,645 E156G probably damaging Het
Spag6 C T 2: 18,734,117 S286L probably benign Het
Stx17 T A 4: 48,183,444 H267Q unknown Het
Tekt3 T C 11: 63,070,232 C76R probably benign Het
Tln1 A T 4: 43,538,281 V1807E possibly damaging Het
Tnfrsf21 A G 17: 43,085,481 D552G probably damaging Het
Ttn C A 2: 76,730,320 V29246L possibly damaging Het
Usp43 C A 11: 67,898,962 C252F probably damaging Het
Vmn2r16 T C 5: 109,340,044 I261T probably benign Het
Vwa5b1 T C 4: 138,581,219 E769G probably benign Het
Xrn1 T A 9: 95,991,193 F670Y probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zdhhc14 A T 17: 5,725,295 Y274F possibly damaging Het
Zeb2 T A 2: 44,996,127 M973L probably benign Het
Zfp638 T C 6: 83,977,053 V1380A possibly damaging Het
Other mutations in Col4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Col4a3 APN 1 82697754 missense unknown
IGL00847:Col4a3 APN 1 82717869 missense probably damaging 1.00
IGL01011:Col4a3 APN 1 82682301 missense unknown
IGL01102:Col4a3 APN 1 82669720 missense unknown
IGL01102:Col4a3 APN 1 82670255 missense unknown
IGL02071:Col4a3 APN 1 82660887 critical splice donor site probably null
IGL02244:Col4a3 APN 1 82669771 splice site probably benign
IGL02380:Col4a3 APN 1 82672788 splice site probably benign
IGL02431:Col4a3 APN 1 82679623 nonsense probably null
IGL02466:Col4a3 APN 1 82670192 missense unknown
IGL02694:Col4a3 APN 1 82710794 unclassified probably benign
IGL02709:Col4a3 APN 1 82679112 missense unknown
IGL02752:Col4a3 APN 1 82660225 missense unknown
IGL02792:Col4a3 APN 1 82718803 missense probably damaging 1.00
IGL03203:Col4a3 APN 1 82672639 nonsense probably null
IGL03218:Col4a3 APN 1 82643206 splice site probably benign
FR4976:Col4a3 UTSW 1 82718906 frame shift probably null
PIT4260001:Col4a3 UTSW 1 82682761 missense unknown
PIT4515001:Col4a3 UTSW 1 82682303 missense unknown
R0035:Col4a3 UTSW 1 82672753 missense unknown
R0099:Col4a3 UTSW 1 82717993 missense probably benign 0.41
R0433:Col4a3 UTSW 1 82670219 missense unknown
R0573:Col4a3 UTSW 1 82716363 missense possibly damaging 0.83
R0606:Col4a3 UTSW 1 82672586 splice site probably benign
R0715:Col4a3 UTSW 1 82652158 splice site probably benign
R0961:Col4a3 UTSW 1 82708576 splice site probably benign
R1257:Col4a3 UTSW 1 82716365 missense probably damaging 1.00
R1264:Col4a3 UTSW 1 82643301 splice site probably benign
R1373:Col4a3 UTSW 1 82690087 splice site probably benign
R1694:Col4a3 UTSW 1 82690663 splice site probably null
R1895:Col4a3 UTSW 1 82679108 missense unknown
R1925:Col4a3 UTSW 1 82700373 missense unknown
R1925:Col4a3 UTSW 1 82711874 unclassified probably benign
R2033:Col4a3 UTSW 1 82718011 intron probably benign
R2044:Col4a3 UTSW 1 82696319 missense unknown
R2122:Col4a3 UTSW 1 82654957 missense unknown
R2282:Col4a3 UTSW 1 82708638 missense unknown
R2318:Col4a3 UTSW 1 82648569 splice site probably null
R2421:Col4a3 UTSW 1 82670275 splice site probably benign
R2517:Col4a3 UTSW 1 82680710 missense unknown
R2965:Col4a3 UTSW 1 82648600 missense unknown
R3085:Col4a3 UTSW 1 82651258 missense unknown
R3150:Col4a3 UTSW 1 82657137 splice site probably null
R3947:Col4a3 UTSW 1 82715332 missense probably damaging 1.00
R4756:Col4a3 UTSW 1 82716297 critical splice acceptor site probably null
R4910:Col4a3 UTSW 1 82672679 missense unknown
R4928:Col4a3 UTSW 1 82710977 unclassified probably benign
R5044:Col4a3 UTSW 1 82666546 missense unknown
R5557:Col4a3 UTSW 1 82715247 unclassified probably benign
R5761:Col4a3 UTSW 1 82716057 nonsense probably null
R5970:Col4a3 UTSW 1 82716329 missense possibly damaging 0.76
R6576:Col4a3 UTSW 1 82708574 splice site probably null
R6583:Col4a3 UTSW 1 82641476 missense unknown
R6675:Col4a3 UTSW 1 82668925 missense unknown
R7170:Col4a3 UTSW 1 82715909 splice site probably null
R7592:Col4a3 UTSW 1 82648617 missense unknown
R7624:Col4a3 UTSW 1 82718884 missense probably benign
R7994:Col4a3 UTSW 1 82662906 missense unknown
R8127:Col4a3 UTSW 1 82649760 missense unknown
R8702:Col4a3 UTSW 1 82710979 missense unknown
X0067:Col4a3 UTSW 1 82716159 missense probably damaging 0.99
Z1177:Col4a3 UTSW 1 82690039 missense unknown
Predicted Primers PCR Primer
(F):5'- CATGCGCACCTGTGTATGTG -3'
(R):5'- TGAAGCATCCACTGTCTCAG -3'

Sequencing Primer
(F):5'- GTGTGAATCAGACATGCACTC -3'
(R):5'- CAGTTTTTCCCTATGCAAGTAGG -3'
Posted On2021-07-15