Incidental Mutation 'R0731:Map4k5'
Institutional Source Beutler Lab
Gene Symbol Map4k5
Ensembl Gene ENSMUSG00000034761
Gene Namemitogen-activated protein kinase kinase kinase kinase 5
SynonymsMAPKKKK5, GCKR, KHS, 4432415E19Rik
MMRRC Submission 038912-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0731 (G1)
Quality Score86
Status Validated
Chromosomal Location69803750-69893200 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 69874264 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049239] [ENSMUST00000110567] [ENSMUST00000110570] [ENSMUST00000171211]
Predicted Effect probably benign
Transcript: ENSMUST00000049239
SMART Domains Protein: ENSMUSP00000047812
Gene: ENSMUSG00000034761

S_TKc 20 277 4.07e-88 SMART
low complexity region 389 396 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
CNH 512 827 4.57e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110567
SMART Domains Protein: ENSMUSP00000106196
Gene: ENSMUSG00000034761

S_TKc 20 277 4.07e-88 SMART
low complexity region 370 377 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
CNH 493 808 3.98e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110570
SMART Domains Protein: ENSMUSP00000106199
Gene: ENSMUSG00000034761

S_TKc 20 277 4.07e-88 SMART
low complexity region 389 396 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
CNH 512 827 3.98e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153712
Predicted Effect probably benign
Transcript: ENSMUST00000171211
SMART Domains Protein: ENSMUSP00000126006
Gene: ENSMUSG00000034761

Pfam:Pkinase_Tyr 1 208 2e-32 PFAM
Pfam:Pkinase 1 210 6.2e-52 PFAM
low complexity region 322 329 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
CNH 445 760 4.57e-142 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family, that is highly similar to yeast SPS1/STE20 kinase. Yeast SPS1/STE20 functions near the beginning of the MAP kinase signal cascades that is essential for yeast pheromone response. This kinase was shown to activate Jun kinase in mammalian cells, which suggested a role in stress response. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and phenotypically normal but show impaired canonical and noncanonical Wnt signaling in progenitor B lymphocytes. Mice homozygous for a gene trap exhibit hypoalgesia, increased serum IgG1 and an increased percentage of peripheral blood CD4+ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,586,203 T66A probably damaging Het
4933406M09Rik A C 1: 134,389,975 M162L probably benign Het
Acsm3 A T 7: 119,768,024 R27* probably null Het
Actg1 A G 11: 120,346,949 F255S probably damaging Het
Ahdc1 T A 4: 133,062,951 V501E possibly damaging Het
Alpk2 A T 18: 65,305,390 D1444E probably damaging Het
Btaf1 T G 19: 36,997,495 probably null Het
Cacnb2 A G 2: 14,985,706 H489R possibly damaging Het
Ccdc162 C A 10: 41,579,143 K398N probably damaging Het
Cd79b G T 11: 106,312,433 S145R probably damaging Het
Cdh11 T A 8: 102,668,019 N264Y probably damaging Het
Celsr1 T C 15: 85,901,597 D2892G probably benign Het
Chuk A G 19: 44,103,766 probably benign Het
Clk3 T C 9: 57,751,126 probably benign Het
Dcaf8 A T 1: 172,172,509 D78V possibly damaging Het
Dctn1 A G 6: 83,183,089 T87A probably damaging Het
Ddx50 T C 10: 62,616,249 N732D unknown Het
Dnah5 A T 15: 28,311,143 Y1756F possibly damaging Het
Dock3 A T 9: 106,969,856 V858E probably damaging Het
Fer1l4 A G 2: 156,024,070 F1566S probably benign Het
Fpr-rs7 T C 17: 20,113,854 I125V probably benign Het
Fuca2 C T 10: 13,506,027 P228L probably benign Het
Galntl6 A G 8: 58,535,984 F57L probably benign Het
Gigyf2 T A 1: 87,407,727 probably benign Het
Gm16505 A T 13: 3,361,329 noncoding transcript Het
Gm4781 T C 10: 100,396,777 noncoding transcript Het
Gm9956 T A 10: 56,745,543 Y100* probably null Het
Gpr137c T A 14: 45,246,349 C178S probably damaging Het
Gpr83 A G 9: 14,868,644 R331G probably benign Het
Hlcs T A 16: 94,131,852 H851L probably damaging Het
Kbtbd6 C A 14: 79,451,884 Y6* probably null Het
Kif23 T C 9: 61,925,032 R610G possibly damaging Het
Kifc3 G A 8: 95,105,733 T487I probably damaging Het
Klra5 A C 6: 129,908,796 D133E possibly damaging Het
Klra6 T C 6: 130,022,705 E100G probably damaging Het
Klre1 T A 6: 129,585,568 probably benign Het
Lancl1 C T 1: 67,009,910 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Man1b1 A G 2: 25,338,155 I146V possibly damaging Het
Mast3 A G 8: 70,781,321 S178P probably damaging Het
Mau2 A G 8: 70,023,612 probably null Het
Mkrn2 A T 6: 115,614,651 N312Y probably damaging Het
Mrvi1 T C 7: 110,876,900 S615G probably benign Het
Myh1 A G 11: 67,202,533 E150G probably damaging Het
Myo7b T A 18: 31,961,825 probably null Het
Nyap1 A G 5: 137,735,298 V491A probably damaging Het
Olfr1284 A G 2: 111,379,293 M98V probably damaging Het
Olfr484 T C 7: 108,124,734 I176M probably benign Het
Olfr518 A T 7: 108,881,533 N24K probably damaging Het
Olfr954 T C 9: 39,461,532 F34L probably damaging Het
Oxsm A T 14: 16,240,893 H385Q probably damaging Het
Pbld2 T C 10: 63,056,811 S242P probably damaging Het
Pdzd7 T C 19: 45,029,305 Y675C probably damaging Het
Pnkd T A 1: 74,351,541 H266Q probably damaging Het
Rbfox2 A G 15: 77,099,279 S141P probably benign Het
Rdx A G 9: 52,068,218 T214A probably benign Het
Ripor2 A T 13: 24,680,644 E219V probably damaging Het
Rufy2 G A 10: 63,011,844 probably benign Het
Slf2 T A 19: 44,975,726 probably benign Het
Snrnp200 G T 2: 127,226,145 probably benign Het
Snx7 T A 3: 117,829,671 probably benign Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Tacr3 G A 3: 134,855,000 probably null Het
Tcerg1 C T 18: 42,571,840 T978M probably damaging Het
Tcf7l1 G T 6: 72,788,269 P126Q possibly damaging Het
Trank1 A G 9: 111,365,488 D860G probably damaging Het
Try4 T C 6: 41,304,367 L81P probably benign Het
Ucp1 T C 8: 83,297,847 probably benign Het
Ugt2b38 G A 5: 87,420,452 A328V probably damaging Het
Wfikkn1 T A 17: 25,878,017 R444S probably damaging Het
Zfc3h1 A G 10: 115,410,632 T875A probably benign Het
Zfp11 A G 5: 129,657,264 S378P probably damaging Het
Zfp984 T A 4: 147,756,232 N54I probably damaging Het
Other mutations in Map4k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Map4k5 APN 12 69845732 missense probably damaging 1.00
IGL01013:Map4k5 APN 12 69827526 splice site probably benign
IGL01309:Map4k5 APN 12 69841963 missense probably benign 0.00
IGL02314:Map4k5 APN 12 69818439 missense probably benign 0.05
IGL02612:Map4k5 APN 12 69849584 missense possibly damaging 0.63
IGL02620:Map4k5 APN 12 69892702 missense probably benign 0.05
IGL02749:Map4k5 APN 12 69815806 missense probably benign 0.25
R0662:Map4k5 UTSW 12 69813153 missense probably damaging 1.00
R0828:Map4k5 UTSW 12 69805326 missense probably damaging 0.98
R1026:Map4k5 UTSW 12 69874288 missense possibly damaging 0.95
R1178:Map4k5 UTSW 12 69816378 missense probably damaging 0.99
R1464:Map4k5 UTSW 12 69805350 missense possibly damaging 0.89
R1464:Map4k5 UTSW 12 69805350 missense possibly damaging 0.89
R1615:Map4k5 UTSW 12 69844413 missense probably damaging 1.00
R1632:Map4k5 UTSW 12 69828047 missense probably benign
R1652:Map4k5 UTSW 12 69830427 critical splice donor site probably null
R1677:Map4k5 UTSW 12 69805308 missense probably benign 0.01
R1835:Map4k5 UTSW 12 69824662 missense probably damaging 1.00
R1895:Map4k5 UTSW 12 69845755 missense probably damaging 1.00
R1946:Map4k5 UTSW 12 69845755 missense probably damaging 1.00
R1968:Map4k5 UTSW 12 69818492 missense probably damaging 0.99
R1971:Map4k5 UTSW 12 69826328 missense possibly damaging 0.81
R1987:Map4k5 UTSW 12 69842912 missense probably damaging 1.00
R2070:Map4k5 UTSW 12 69816337 missense probably damaging 0.99
R2471:Map4k5 UTSW 12 69856846 missense probably benign 0.30
R3417:Map4k5 UTSW 12 69809264 missense probably damaging 1.00
R4133:Map4k5 UTSW 12 69845723 missense probably damaging 1.00
R4331:Map4k5 UTSW 12 69827374 missense probably benign 0.00
R4388:Map4k5 UTSW 12 69845809 missense probably damaging 1.00
R4685:Map4k5 UTSW 12 69811366 missense probably benign
R4760:Map4k5 UTSW 12 69824598 missense possibly damaging 0.49
R4822:Map4k5 UTSW 12 69841984 nonsense probably null
R4863:Map4k5 UTSW 12 69818438 missense probably benign 0.04
R4971:Map4k5 UTSW 12 69852719 missense possibly damaging 0.60
R5038:Map4k5 UTSW 12 69824614 missense probably damaging 1.00
R5055:Map4k5 UTSW 12 69831558 missense probably benign
R5248:Map4k5 UTSW 12 69841981 missense probably benign 0.36
R5428:Map4k5 UTSW 12 69838013 missense possibly damaging 0.94
R5697:Map4k5 UTSW 12 69830436 missense probably benign
R5757:Map4k5 UTSW 12 69824655 missense probably damaging 1.00
R5955:Map4k5 UTSW 12 69844390 missense probably damaging 1.00
R6258:Map4k5 UTSW 12 69831562 missense probably benign 0.06
R6259:Map4k5 UTSW 12 69852740 missense probably damaging 0.97
R6260:Map4k5 UTSW 12 69831562 missense probably benign 0.06
R6796:Map4k5 UTSW 12 69818025 missense probably benign 0.01
R6979:Map4k5 UTSW 12 69822848 missense probably damaging 1.00
R7164:Map4k5 UTSW 12 69830436 missense probably benign
R7184:Map4k5 UTSW 12 69874321 missense probably benign 0.00
R7598:Map4k5 UTSW 12 69824638 missense possibly damaging 0.75
R8395:Map4k5 UTSW 12 69830429 missense probably null
R8445:Map4k5 UTSW 12 69850967 missense probably damaging 1.00
R8757:Map4k5 UTSW 12 69850824 critical splice donor site probably benign
R8827:Map4k5 UTSW 12 69856861 missense possibly damaging 0.88
R8896:Map4k5 UTSW 12 69823501 missense possibly damaging 0.94
R8898:Map4k5 UTSW 12 69813157 missense possibly damaging 0.88
RF002:Map4k5 UTSW 12 69856856 missense probably damaging 0.96
X0062:Map4k5 UTSW 12 69824607 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTAGCAacatacacacacacacacac -3'

Sequencing Primer
(F):5'- acacttacacacatacatacatacac -3'
(R):5'- tctgtcacttgaaacattgcc -3'
Posted On2013-09-03