Incidental Mutation 'R8865:Spag6'
ID 675840
Institutional Source Beutler Lab
Gene Symbol Spag6
Ensembl Gene ENSMUSG00000037708
Gene Name sperm associated antigen 6
Synonyms BC061194, Spag6l
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8865 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 18694032-18750413 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 18734117 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 286 (S286L)
Ref Sequence ENSEMBL: ENSMUSP00000092751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095132] [ENSMUST00000173763]
AlphaFold Q3V0U9
Predicted Effect probably benign
Transcript: ENSMUST00000095132
AA Change: S286L

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092751
Gene: ENSMUSG00000037708
AA Change: S286L

DomainStartEndE-ValueType
ARM 30 70 2.26e-3 SMART
ARM 114 154 1.67e-6 SMART
ARM 156 196 4.28e-4 SMART
ARM 198 238 5.43e-6 SMART
ARM 240 280 4.6e0 SMART
ARM 282 322 3.09e1 SMART
ARM 323 365 3.93e-3 SMART
Blast:ARM 367 409 7e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173763
SMART Domains Protein: ENSMUSP00000133383
Gene: ENSMUSG00000037708

DomainStartEndE-ValueType
ARM 8 48 2.26e-3 SMART
Blast:ARM 50 90 2e-14 BLAST
ARM 92 132 1.67e-6 SMART
ARM 134 166 5.76e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T A 11: 50,781,744 Y606* probably null Het
Adgrb1 A G 15: 74,543,658 I696V possibly damaging Het
Ass1 A G 2: 31,520,395 Q406R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccdc148 T C 2: 58,829,820 K409R possibly damaging Het
Ccnl1 A T 3: 65,946,848 S451T probably benign Het
Cdc123 T C 2: 5,795,424 probably benign Het
Cep192 T C 18: 67,834,632 V729A probably benign Het
Chd6 G A 2: 161,021,069 A444V probably benign Het
Chl1 A G 6: 103,708,861 K898E probably damaging Het
Chrng T C 1: 87,207,497 V154A probably damaging Het
Cog1 T G 11: 113,658,498 M799R probably benign Het
Col4a3 G A 1: 82,669,762 probably null Het
Coro6 C A 11: 77,469,091 T366K probably damaging Het
Cwh43 G A 5: 73,441,359 M640I probably benign Het
Cyp2c55 A G 19: 39,031,434 E272G probably benign Het
Cyp4f39 A G 17: 32,483,297 Y256C probably damaging Het
Dbx2 G A 15: 95,632,400 R229* probably null Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
En1 G T 1: 120,603,000 probably benign Het
F3 T A 3: 121,729,411 V90E probably damaging Het
Fam171a1 A G 2: 3,225,903 K691R probably damaging Het
Foxp2 C T 6: 15,415,094 A609V unknown Het
Hemgn A T 4: 46,396,682 S185T possibly damaging Het
Hk1 C T 10: 62,315,515 D33N probably benign Het
Igfbp1 T A 11: 7,201,929 V244D probably damaging Het
Insr A T 8: 3,161,358 D1160E probably damaging Het
Irs1 A T 1: 82,288,109 Y795* probably null Het
Krtap28-10 T C 1: 83,042,087 K111E unknown Het
Lbx1 T G 19: 45,235,166 D21A probably benign Het
Map6 G T 7: 99,268,985 A322S probably benign Het
Mat1a T C 14: 41,121,831 Y336H probably damaging Het
Mcf2l A G 8: 12,880,003 I8V probably benign Het
Med12l T C 3: 59,071,882 V276A probably benign Het
Mettl17 A G 14: 51,884,851 probably benign Het
Mllt1 T C 17: 56,900,295 D183G possibly damaging Het
Msmb T A 14: 32,150,260 C69* probably null Het
Mterf1a A G 5: 3,891,425 S148P probably damaging Het
Mybl2 A G 2: 163,080,733 I583V probably benign Het
Nbr1 T A 11: 101,564,694 D91E probably benign Het
Notch3 A G 17: 32,122,116 Y2221H probably benign Het
Npat C A 9: 53,570,640 T1216N probably benign Het
Olfr1082 C A 2: 86,594,400 V143F possibly damaging Het
Olfr127 T C 17: 37,904,224 L226P probably damaging Het
Olfr137 T A 17: 38,304,981 H160L probably damaging Het
Pawr T A 10: 108,382,742 Y170N probably damaging Het
Pde12 T C 14: 26,669,125 D143G possibly damaging Het
Phactr2 A G 10: 13,253,732 I264T probably benign Het
Pip5k1b A G 19: 24,397,058 L53P probably damaging Het
Pknox1 T C 17: 31,599,546 I251T probably benign Het
Plcxd1 A T 5: 110,101,975 probably benign Het
Polr3c C T 3: 96,715,201 probably benign Het
Ppil2 T C 16: 17,097,405 N113S probably benign Het
Pramel4 G C 4: 144,068,482 G483R probably damaging Het
Prdm10 T C 9: 31,327,397 L195P probably damaging Het
Prss16 A T 13: 22,003,005 L465Q possibly damaging Het
Psg25 G T 7: 18,529,594 H101Q possibly damaging Het
Pstpip2 A G 18: 77,846,408 D55G possibly damaging Het
Rfc1 A T 5: 65,278,792 D636E possibly damaging Het
Scarf2 G T 16: 17,803,110 C214F probably damaging Het
Sirt4 T C 5: 115,482,645 E156G probably damaging Het
Stx17 T A 4: 48,183,444 H267Q unknown Het
Tekt3 T C 11: 63,070,232 C76R probably benign Het
Tln1 A T 4: 43,538,281 V1807E possibly damaging Het
Tnfrsf21 A G 17: 43,085,481 D552G probably damaging Het
Ttn C A 2: 76,730,320 V29246L possibly damaging Het
Usp43 C A 11: 67,898,962 C252F probably damaging Het
Vmn2r16 T C 5: 109,340,044 I261T probably benign Het
Vwa5b1 T C 4: 138,581,219 E769G probably benign Het
Xrn1 T A 9: 95,991,193 F670Y probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zdhhc14 A T 17: 5,725,295 Y274F possibly damaging Het
Zeb2 T A 2: 44,996,127 M973L probably benign Het
Zfp638 T C 6: 83,977,053 V1380A possibly damaging Het
Other mutations in Spag6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Spag6 APN 2 18734184 missense probably benign 0.31
IGL01352:Spag6 APN 2 18710473 missense possibly damaging 0.77
IGL02795:Spag6 APN 2 18733083 missense probably benign
IGL03406:Spag6 APN 2 18742873 splice site probably benign
R0362:Spag6 UTSW 2 18710491 missense probably damaging 0.99
R0423:Spag6 UTSW 2 18710593 missense probably benign 0.00
R1309:Spag6 UTSW 2 18734216 missense probably damaging 1.00
R1386:Spag6 UTSW 2 18734246 missense possibly damaging 0.49
R1568:Spag6 UTSW 2 18733114 missense probably benign
R1716:Spag6 UTSW 2 18745609 splice site probably null
R1771:Spag6 UTSW 2 18734117 missense probably benign 0.22
R1911:Spag6 UTSW 2 18715805 nonsense probably null
R1985:Spag6 UTSW 2 18732119 missense probably benign 0.00
R2029:Spag6 UTSW 2 18734105 unclassified probably benign
R2131:Spag6 UTSW 2 18733097 nonsense probably null
R3705:Spag6 UTSW 2 18710557 missense probably damaging 0.99
R4230:Spag6 UTSW 2 18715638 splice site probably null
R4585:Spag6 UTSW 2 18732147 critical splice donor site probably null
R4586:Spag6 UTSW 2 18732147 critical splice donor site probably null
R4692:Spag6 UTSW 2 18699243 missense probably benign 0.24
R4745:Spag6 UTSW 2 18737296 missense possibly damaging 0.78
R4890:Spag6 UTSW 2 18742777 missense probably benign 0.00
R4914:Spag6 UTSW 2 18745549 missense probably benign 0.00
R4918:Spag6 UTSW 2 18745549 missense probably benign 0.00
R5086:Spag6 UTSW 2 18742877 splice site probably benign
R5264:Spag6 UTSW 2 18745513 missense probably benign 0.00
R5729:Spag6 UTSW 2 18715714 missense probably benign
R5754:Spag6 UTSW 2 18698802 unclassified probably benign
R5781:Spag6 UTSW 2 18731993 missense probably benign
R5954:Spag6 UTSW 2 18710606 missense probably damaging 1.00
R6246:Spag6 UTSW 2 18699095 critical splice donor site probably null
R7607:Spag6 UTSW 2 18731962 missense possibly damaging 0.87
R8261:Spag6 UTSW 2 18745490 missense probably benign 0.01
R8411:Spag6 UTSW 2 18710583 missense probably damaging 1.00
R9275:Spag6 UTSW 2 18699174 missense probably benign 0.28
R9278:Spag6 UTSW 2 18699174 missense probably benign 0.28
R9413:Spag6 UTSW 2 18734218 missense probably benign
R9451:Spag6 UTSW 2 18710558 nonsense probably null
R9660:Spag6 UTSW 2 18699236 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GCCTTTGGACATCGATTCATCC -3'
(R):5'- TGGTTCTACCATGAAATCGAGG -3'

Sequencing Primer
(F):5'- GGACATCGATTCATCCTTATACTCAG -3'
(R):5'- TTCTACCATGAAATCGAGGAGAAAG -3'
Posted On 2021-07-15