Incidental Mutation 'R8865:Chd6'
ID 675846
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Name chromodomain helicase DNA binding protein 6
Synonyms 5430439G14Rik, 6330406J24Rik
MMRRC Submission 068681-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.745) question?
Stock # R8865 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 160788898-160950995 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 160862989 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 444 (A444V)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000134178]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039782
AA Change: A444V

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: A444V

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133
AA Change: A443V

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
CHROMO 288 354 1.35e-4 SMART
CHROMO 371 429 3.48e-7 SMART
DEXDc 455 657 1.73e-39 SMART
HELICc 811 895 3.84e-23 SMART
low complexity region 1079 1093 N/A INTRINSIC
Blast:DEXDc 1107 1152 4e-23 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T A 11: 50,672,571 (GRCm39) Y606* probably null Het
Adgrb1 A G 15: 74,415,507 (GRCm39) I696V possibly damaging Het
Ass1 A G 2: 31,410,407 (GRCm39) Q406R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 95,990,808 (GRCm39) probably benign Het
Ccdc148 T C 2: 58,719,832 (GRCm39) K409R possibly damaging Het
Ccnl1 A T 3: 65,854,269 (GRCm39) S451T probably benign Het
Cdc123 T C 2: 5,800,235 (GRCm39) probably benign Het
Cep192 T C 18: 67,967,703 (GRCm39) V729A probably benign Het
Chl1 A G 6: 103,685,822 (GRCm39) K898E probably damaging Het
Chrng T C 1: 87,135,219 (GRCm39) V154A probably damaging Het
Cog1 T G 11: 113,549,324 (GRCm39) M799R probably benign Het
Col4a3 G A 1: 82,647,483 (GRCm39) probably null Het
Coro6 C A 11: 77,359,917 (GRCm39) T366K probably damaging Het
Cwh43 G A 5: 73,598,702 (GRCm39) M640I probably benign Het
Cyp2c55 A G 19: 39,019,878 (GRCm39) E272G probably benign Het
Cyp4f39 A G 17: 32,702,271 (GRCm39) Y256C probably damaging Het
Dbx2 G A 15: 95,530,281 (GRCm39) R229* probably null Het
Dcdc2a C T 13: 25,386,266 (GRCm39) A380V probably benign Het
En1 G T 1: 120,530,729 (GRCm39) probably benign Het
F3 T A 3: 121,523,060 (GRCm39) V90E probably damaging Het
Fam171a1 A G 2: 3,226,940 (GRCm39) K691R probably damaging Het
Foxp2 C T 6: 15,415,093 (GRCm39) A609V unknown Het
Hemgn A T 4: 46,396,682 (GRCm39) S185T possibly damaging Het
Hk1 C T 10: 62,151,294 (GRCm39) D33N probably benign Het
Igfbp1 T A 11: 7,151,929 (GRCm39) V244D probably damaging Het
Insr A T 8: 3,211,358 (GRCm39) D1160E probably damaging Het
Irs1 A T 1: 82,265,830 (GRCm39) Y795* probably null Het
Krtap28-10 T C 1: 83,019,808 (GRCm39) K111E unknown Het
Lbx1 T G 19: 45,223,605 (GRCm39) D21A probably benign Het
Map6 G T 7: 98,918,192 (GRCm39) A322S probably benign Het
Mat1a T C 14: 40,843,788 (GRCm39) Y336H probably damaging Het
Mcf2l A G 8: 12,930,003 (GRCm39) I8V probably benign Het
Med12l T C 3: 58,979,303 (GRCm39) V276A probably benign Het
Mettl17 A G 14: 52,122,308 (GRCm39) probably benign Het
Mllt1 T C 17: 57,207,295 (GRCm39) D183G possibly damaging Het
Msmb T A 14: 31,872,217 (GRCm39) C69* probably null Het
Mterf1a A G 5: 3,941,425 (GRCm39) S148P probably damaging Het
Mybl2 A G 2: 162,922,653 (GRCm39) I583V probably benign Het
Nbr1 T A 11: 101,455,520 (GRCm39) D91E probably benign Het
Notch3 A G 17: 32,341,090 (GRCm39) Y2221H probably benign Het
Npat C A 9: 53,481,940 (GRCm39) T1216N probably benign Het
Or14j6 T C 17: 38,215,115 (GRCm39) L226P probably damaging Het
Or2j3 T A 17: 38,615,872 (GRCm39) H160L probably damaging Het
Or8k35 C A 2: 86,424,744 (GRCm39) V143F possibly damaging Het
Pawr T A 10: 108,218,603 (GRCm39) Y170N probably damaging Het
Pde12 T C 14: 26,390,280 (GRCm39) D143G possibly damaging Het
Phactr2 A G 10: 13,129,476 (GRCm39) I264T probably benign Het
Pip5k1b A G 19: 24,374,422 (GRCm39) L53P probably damaging Het
Pknox1 T C 17: 31,818,520 (GRCm39) I251T probably benign Het
Plcxd1 A T 5: 110,249,841 (GRCm39) probably benign Het
Polr3c C T 3: 96,622,517 (GRCm39) probably benign Het
Pramel4 G C 4: 143,795,052 (GRCm39) G483R probably damaging Het
Prdm10 T C 9: 31,238,693 (GRCm39) L195P probably damaging Het
Prss16 A T 13: 22,187,175 (GRCm39) L465Q possibly damaging Het
Psg25 G T 7: 18,263,519 (GRCm39) H101Q possibly damaging Het
Pstpip2 A G 18: 77,934,108 (GRCm39) D55G possibly damaging Het
Rfc1 A T 5: 65,436,135 (GRCm39) D636E possibly damaging Het
Scarf2 G T 16: 17,620,974 (GRCm39) C214F probably damaging Het
Sirt4 T C 5: 115,620,704 (GRCm39) E156G probably damaging Het
Spag6 C T 2: 18,738,928 (GRCm39) S286L probably benign Het
Stx17 T A 4: 48,183,444 (GRCm39) H267Q unknown Het
Tekt3 T C 11: 62,961,058 (GRCm39) C76R probably benign Het
Tln1 A T 4: 43,538,281 (GRCm39) V1807E possibly damaging Het
Tnfrsf21 A G 17: 43,396,372 (GRCm39) D552G probably damaging Het
Ttn C A 2: 76,560,664 (GRCm39) V29246L possibly damaging Het
Usp43 C A 11: 67,789,788 (GRCm39) C252F probably damaging Het
Vmn2r16 T C 5: 109,487,910 (GRCm39) I261T probably benign Het
Vwa5b1 T C 4: 138,308,530 (GRCm39) E769G probably benign Het
Xrn1 T A 9: 95,873,246 (GRCm39) F670Y probably benign Het
Ypel1 T C 16: 16,915,269 (GRCm39) N113S probably benign Het
Zc3h7b G A 15: 81,656,681 (GRCm39) R166Q probably benign Het
Zdhhc14 A T 17: 5,775,570 (GRCm39) Y274F possibly damaging Het
Zeb2 T A 2: 44,886,139 (GRCm39) M973L probably benign Het
Zfp638 T C 6: 83,954,035 (GRCm39) V1380A possibly damaging Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 160,883,999 (GRCm39) missense probably benign 0.01
IGL00899:Chd6 APN 2 160,871,218 (GRCm39) splice site probably benign
IGL01104:Chd6 APN 2 160,803,847 (GRCm39) missense probably damaging 1.00
IGL01295:Chd6 APN 2 160,830,290 (GRCm39) splice site probably benign
IGL01717:Chd6 APN 2 160,807,179 (GRCm39) missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160,803,294 (GRCm39) missense probably benign 0.00
IGL01814:Chd6 APN 2 160,901,849 (GRCm39) missense probably benign 0.25
IGL02016:Chd6 APN 2 160,825,598 (GRCm39) missense probably damaging 1.00
IGL02104:Chd6 APN 2 160,819,432 (GRCm39) missense probably benign
IGL02158:Chd6 APN 2 160,868,212 (GRCm39) missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160,807,595 (GRCm39) missense probably damaging 1.00
IGL02472:Chd6 APN 2 160,826,372 (GRCm39) splice site probably benign
IGL02522:Chd6 APN 2 160,807,716 (GRCm39) missense probably benign 0.30
IGL02626:Chd6 APN 2 160,881,270 (GRCm39) splice site probably benign
IGL02727:Chd6 APN 2 160,811,383 (GRCm39) missense probably damaging 0.96
IGL02738:Chd6 APN 2 160,807,618 (GRCm39) missense probably benign 0.45
IGL02743:Chd6 APN 2 160,802,183 (GRCm39) missense probably damaging 1.00
IGL02800:Chd6 APN 2 160,826,552 (GRCm39) missense probably damaging 1.00
IGL02811:Chd6 APN 2 160,832,221 (GRCm39) missense probably damaging 1.00
IGL02850:Chd6 APN 2 160,861,536 (GRCm39) nonsense probably null
IGL02979:Chd6 APN 2 160,808,090 (GRCm39) missense possibly damaging 0.48
IGL02993:Chd6 APN 2 160,894,304 (GRCm39) splice site probably benign
IGL03277:Chd6 APN 2 160,824,981 (GRCm39) missense probably null 1.00
IGL03346:Chd6 APN 2 160,802,282 (GRCm39) missense probably benign 0.00
IGL03357:Chd6 APN 2 160,859,936 (GRCm39) splice site probably benign
IGL03134:Chd6 UTSW 2 160,807,403 (GRCm39) missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160,809,822 (GRCm39) missense probably damaging 1.00
R0106:Chd6 UTSW 2 160,809,822 (GRCm39) missense probably damaging 1.00
R0212:Chd6 UTSW 2 160,894,767 (GRCm39) missense probably damaging 0.99
R0363:Chd6 UTSW 2 160,856,244 (GRCm39) missense probably damaging 1.00
R0399:Chd6 UTSW 2 160,894,608 (GRCm39) missense probably damaging 1.00
R0511:Chd6 UTSW 2 160,834,111 (GRCm39) missense probably damaging 0.99
R0771:Chd6 UTSW 2 160,861,500 (GRCm39) missense probably damaging 1.00
R1147:Chd6 UTSW 2 160,832,191 (GRCm39) missense probably damaging 1.00
R1147:Chd6 UTSW 2 160,832,191 (GRCm39) missense probably damaging 1.00
R1184:Chd6 UTSW 2 160,872,722 (GRCm39) missense probably damaging 1.00
R1277:Chd6 UTSW 2 160,809,735 (GRCm39) missense probably damaging 1.00
R1396:Chd6 UTSW 2 160,825,023 (GRCm39) missense probably damaging 1.00
R1647:Chd6 UTSW 2 160,883,978 (GRCm39) missense probably damaging 1.00
R1648:Chd6 UTSW 2 160,883,978 (GRCm39) missense probably damaging 1.00
R1745:Chd6 UTSW 2 160,823,587 (GRCm39) missense probably damaging 0.96
R1766:Chd6 UTSW 2 160,808,559 (GRCm39) missense probably damaging 1.00
R1871:Chd6 UTSW 2 160,832,176 (GRCm39) missense probably damaging 1.00
R1928:Chd6 UTSW 2 160,809,920 (GRCm39) splice site probably benign
R1973:Chd6 UTSW 2 160,808,307 (GRCm39) missense probably damaging 0.99
R2200:Chd6 UTSW 2 160,825,673 (GRCm39) missense probably damaging 1.00
R2340:Chd6 UTSW 2 160,807,679 (GRCm39) frame shift probably null
R2341:Chd6 UTSW 2 160,807,679 (GRCm39) frame shift probably null
R2519:Chd6 UTSW 2 160,871,796 (GRCm39) missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160,809,800 (GRCm39) missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160,808,472 (GRCm39) small deletion probably benign
R3426:Chd6 UTSW 2 160,832,175 (GRCm39) missense probably damaging 1.00
R3427:Chd6 UTSW 2 160,832,175 (GRCm39) missense probably damaging 1.00
R4042:Chd6 UTSW 2 160,830,253 (GRCm39) missense probably damaging 1.00
R4273:Chd6 UTSW 2 160,803,211 (GRCm39) missense probably benign 0.04
R4360:Chd6 UTSW 2 160,791,776 (GRCm39) missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160,807,238 (GRCm39) missense probably benign
R4458:Chd6 UTSW 2 160,871,796 (GRCm39) missense possibly damaging 0.66
R4583:Chd6 UTSW 2 160,856,114 (GRCm39) missense probably damaging 1.00
R4625:Chd6 UTSW 2 160,811,412 (GRCm39) missense probably damaging 1.00
R4740:Chd6 UTSW 2 160,812,103 (GRCm39) missense probably benign
R4765:Chd6 UTSW 2 160,808,164 (GRCm39) nonsense probably null
R4779:Chd6 UTSW 2 160,791,477 (GRCm39) missense probably damaging 1.00
R4877:Chd6 UTSW 2 160,871,219 (GRCm39) splice site probably benign
R5068:Chd6 UTSW 2 160,808,289 (GRCm39) missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160,791,873 (GRCm39) missense probably damaging 1.00
R5275:Chd6 UTSW 2 160,811,283 (GRCm39) missense probably benign
R5405:Chd6 UTSW 2 160,807,310 (GRCm39) missense probably benign
R5598:Chd6 UTSW 2 160,856,032 (GRCm39) missense probably damaging 1.00
R5693:Chd6 UTSW 2 160,807,185 (GRCm39) missense probably benign
R5697:Chd6 UTSW 2 160,859,971 (GRCm39) missense probably damaging 1.00
R5715:Chd6 UTSW 2 160,791,798 (GRCm39) missense probably benign 0.00
R5759:Chd6 UTSW 2 160,825,682 (GRCm39) missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160,798,999 (GRCm39) missense probably damaging 1.00
R5761:Chd6 UTSW 2 160,798,998 (GRCm39) missense probably damaging 1.00
R5954:Chd6 UTSW 2 160,807,747 (GRCm39) missense probably benign 0.00
R6025:Chd6 UTSW 2 160,807,502 (GRCm39) missense probably benign
R6104:Chd6 UTSW 2 160,856,052 (GRCm39) missense probably damaging 1.00
R6247:Chd6 UTSW 2 160,791,968 (GRCm39) missense probably damaging 1.00
R6393:Chd6 UTSW 2 160,821,407 (GRCm39) missense probably damaging 1.00
R6452:Chd6 UTSW 2 160,807,418 (GRCm39) missense possibly damaging 0.76
R6468:Chd6 UTSW 2 160,854,987 (GRCm39) missense probably damaging 1.00
R6784:Chd6 UTSW 2 160,808,174 (GRCm39) missense probably damaging 1.00
R6803:Chd6 UTSW 2 160,802,279 (GRCm39) missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160,807,650 (GRCm39) missense probably benign
R6895:Chd6 UTSW 2 160,830,260 (GRCm39) missense probably damaging 1.00
R6925:Chd6 UTSW 2 160,855,047 (GRCm39) missense probably damaging 0.98
R7061:Chd6 UTSW 2 160,867,885 (GRCm39) nonsense probably null
R7064:Chd6 UTSW 2 160,791,983 (GRCm39) missense probably damaging 1.00
R7248:Chd6 UTSW 2 160,803,199 (GRCm39) nonsense probably null
R7287:Chd6 UTSW 2 160,850,312 (GRCm39) missense probably benign 0.07
R7431:Chd6 UTSW 2 160,868,248 (GRCm39) missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160,791,923 (GRCm39) missense probably damaging 1.00
R7509:Chd6 UTSW 2 160,855,074 (GRCm39) missense probably damaging 1.00
R7699:Chd6 UTSW 2 160,867,863 (GRCm39) missense probably benign 0.13
R7748:Chd6 UTSW 2 160,808,539 (GRCm39) missense probably benign 0.37
R7785:Chd6 UTSW 2 160,812,095 (GRCm39) missense possibly damaging 0.51
R8002:Chd6 UTSW 2 160,832,241 (GRCm39) missense probably damaging 1.00
R8261:Chd6 UTSW 2 160,799,002 (GRCm39) missense probably damaging 1.00
R8317:Chd6 UTSW 2 160,832,241 (GRCm39) missense probably damaging 1.00
R8388:Chd6 UTSW 2 160,861,571 (GRCm39) missense probably damaging 1.00
R8867:Chd6 UTSW 2 160,862,989 (GRCm39) missense probably benign 0.10
R8996:Chd6 UTSW 2 160,823,543 (GRCm39) missense probably damaging 1.00
R9091:Chd6 UTSW 2 160,871,793 (GRCm39) nonsense probably null
R9270:Chd6 UTSW 2 160,871,793 (GRCm39) nonsense probably null
R9310:Chd6 UTSW 2 160,881,181 (GRCm39) missense probably damaging 1.00
R9367:Chd6 UTSW 2 160,871,784 (GRCm39) missense possibly damaging 0.83
R9438:Chd6 UTSW 2 160,799,078 (GRCm39) missense probably benign 0.01
R9756:Chd6 UTSW 2 160,802,259 (GRCm39) missense probably benign
Z1088:Chd6 UTSW 2 160,808,408 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACCTCAGGTCAAGGCAAC -3'
(R):5'- CTAAGGGTGTTCAATGCCCCAG -3'

Sequencing Primer
(F):5'- CAAAGGCAGCTGCAGTGTGTG -3'
(R):5'- TTCAATGCCCCAGTGTAGG -3'
Posted On 2021-07-15