Mutagenetix > Incidental Mutation

Incidental Mutation 'R8865:Chd6'

675846

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.674) question?

Stock #

R8865 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 161021069 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 444 (A444V)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000134178]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000039782
AA Change: A444V

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: A444V

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133
AA Change: A443V

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	213	228	N/A	INTRINSIC
CHROMO	288	354	1.35e-4	SMART
CHROMO	371	429	3.48e-7	SMART
DEXDc	455	657	1.73e-39	SMART
HELICc	811	895	3.84e-23	SMART
low complexity region	1079	1093	N/A	INTRINSIC
Blast:DEXDc	1107	1152	4e-23	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	T	A	11: 50,781,744	Y606*	probably null	Het
Adgrb1	A	G	15: 74,543,658	I696V	possibly damaging	Het
Ass1	A	G	2: 31,520,395	Q406R	probably benign	Het
Calcoco2	GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC	GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC	11: 96,099,982		probably benign	Het
Ccdc148	T	C	2: 58,829,820	K409R	possibly damaging	Het
Ccnl1	A	T	3: 65,946,848	S451T	probably benign	Het
Cdc123	T	C	2: 5,795,424		probably benign	Het
Cep192	T	C	18: 67,834,632	V729A	probably benign	Het
Chl1	A	G	6: 103,708,861	K898E	probably damaging	Het
Chrng	T	C	1: 87,207,497	V154A	probably damaging	Het
Cog1	T	G	11: 113,658,498	M799R	probably benign	Het
Col4a3	G	A	1: 82,669,762		probably null	Het
Coro6	C	A	11: 77,469,091	T366K	probably damaging	Het
Cwh43	G	A	5: 73,441,359	M640I	probably benign	Het
Cyp2c55	A	G	19: 39,031,434	E272G	probably benign	Het
Cyp4f39	A	G	17: 32,483,297	Y256C	probably damaging	Het
Dbx2	G	A	15: 95,632,400	R229*	probably null	Het
Dcdc2a	C	T	13: 25,202,283	A380V	probably benign	Het
En1	G	T	1: 120,603,000		probably benign	Het
F3	T	A	3: 121,729,411	V90E	probably damaging	Het
Fam171a1	A	G	2: 3,225,903	K691R	probably damaging	Het
Foxp2	C	T	6: 15,415,094	A609V	unknown	Het
Hemgn	A	T	4: 46,396,682	S185T	possibly damaging	Het
Hk1	C	T	10: 62,315,515	D33N	probably benign	Het
Igfbp1	T	A	11: 7,201,929	V244D	probably damaging	Het
Insr	A	T	8: 3,161,358	D1160E	probably damaging	Het
Irs1	A	T	1: 82,288,109	Y795*	probably null	Het
Krtap28-10	T	C	1: 83,042,087	K111E	unknown	Het
Lbx1	T	G	19: 45,235,166	D21A	probably benign	Het
Map6	G	T	7: 99,268,985	A322S	probably benign	Het
Mat1a	T	C	14: 41,121,831	Y336H	probably damaging	Het
Mcf2l	A	G	8: 12,880,003	I8V	probably benign	Het
Med12l	T	C	3: 59,071,882	V276A	probably benign	Het
Mettl17	A	G	14: 51,884,851		probably benign	Het
Mllt1	T	C	17: 56,900,295	D183G	possibly damaging	Het
Msmb	T	A	14: 32,150,260	C69*	probably null	Het
Mterf1a	A	G	5: 3,891,425	S148P	probably damaging	Het
Mybl2	A	G	2: 163,080,733	I583V	probably benign	Het
Nbr1	T	A	11: 101,564,694	D91E	probably benign	Het
Notch3	A	G	17: 32,122,116	Y2221H	probably benign	Het
Npat	C	A	9: 53,570,640	T1216N	probably benign	Het
Olfr1082	C	A	2: 86,594,400	V143F	possibly damaging	Het
Olfr127	T	C	17: 37,904,224	L226P	probably damaging	Het
Olfr137	T	A	17: 38,304,981	H160L	probably damaging	Het
Pawr	T	A	10: 108,382,742	Y170N	probably damaging	Het
Pde12	T	C	14: 26,669,125	D143G	possibly damaging	Het
Phactr2	A	G	10: 13,253,732	I264T	probably benign	Het
Pip5k1b	A	G	19: 24,397,058	L53P	probably damaging	Het
Pknox1	T	C	17: 31,599,546	I251T	probably benign	Het
Plcxd1	A	T	5: 110,101,975		probably benign	Het
Polr3c	C	T	3: 96,715,201		probably benign	Het
Ppil2	T	C	16: 17,097,405	N113S	probably benign	Het
Pramel4	G	C	4: 144,068,482	G483R	probably damaging	Het
Prdm10	T	C	9: 31,327,397	L195P	probably damaging	Het
Prss16	A	T	13: 22,003,005	L465Q	possibly damaging	Het
Psg25	G	T	7: 18,529,594	H101Q	possibly damaging	Het
Pstpip2	A	G	18: 77,846,408	D55G	possibly damaging	Het
Rfc1	A	T	5: 65,278,792	D636E	possibly damaging	Het
Scarf2	G	T	16: 17,803,110	C214F	probably damaging	Het
Sirt4	T	C	5: 115,482,645	E156G	probably damaging	Het
Spag6	C	T	2: 18,734,117	S286L	probably benign	Het
Stx17	T	A	4: 48,183,444	H267Q	unknown	Het
Tekt3	T	C	11: 63,070,232	C76R	probably benign	Het
Tln1	A	T	4: 43,538,281	V1807E	possibly damaging	Het
Tnfrsf21	A	G	17: 43,085,481	D552G	probably damaging	Het
Ttn	C	A	2: 76,730,320	V29246L	possibly damaging	Het
Usp43	C	A	11: 67,898,962	C252F	probably damaging	Het
Vmn2r16	T	C	5: 109,340,044	I261T	probably benign	Het
Vwa5b1	T	C	4: 138,581,219	E769G	probably benign	Het
Xrn1	T	A	9: 95,991,193	F670Y	probably benign	Het
Zc3h7b	G	A	15: 81,772,480	R166Q	probably benign	Het
Zdhhc14	A	T	17: 5,725,295	Y274F	possibly damaging	Het
Zeb2	T	A	2: 44,996,127	M973L	probably benign	Het
Zfp638	T	C	6: 83,977,053	V1380A	possibly damaging	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161042079	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161029298	splice site	probably benign
IGL01104:Chd6	APN	2	160961927	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160988370	splice site	probably benign
IGL01717:Chd6	APN	2	160965259	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160961374	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161059929	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160983678	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160977512	missense	probably benign
IGL02158:Chd6	APN	2	161026292	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160965675	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160984452	splice site	probably benign
IGL02522:Chd6	APN	2	160965796	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161039350	splice site	probably benign
IGL02727:Chd6	APN	2	160969463	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160965698	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160960263	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160984632	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160990301	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161019616	nonsense	probably null
IGL02979:Chd6	APN	2	160966170	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161052384	splice site	probably benign
IGL03277:Chd6	APN	2	160983061	missense	probably null	1.00
IGL03346:Chd6	APN	2	160960362	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161018016	splice site	probably benign
IGL03134:Chd6	UTSW	2	160965483	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	161052847	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	161014324	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161052688	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160992191	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	161019580	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161030802	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160967815	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160983103	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160981667	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160966639	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160990256	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160968000	splice site	probably benign
R1973:Chd6	UTSW	2	160966387	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160983753	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160965759	frame shift	probably null
R2341:Chd6	UTSW	2	160965759	frame shift	probably null
R2519:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160967880	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160966552	small deletion	probably benign
R3426:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160988333	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160961291	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160949856	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160965318	missense	probably benign
R4458:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161014194	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160969492	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160970183	missense	probably benign
R4765:Chd6	UTSW	2	160966244	nonsense	probably null
R4779:Chd6	UTSW	2	160949557	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	161029299	splice site	probably benign
R5068:Chd6	UTSW	2	160966369	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160949953	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160969363	missense	probably benign
R5405:Chd6	UTSW	2	160965390	missense	probably benign
R5598:Chd6	UTSW	2	161014112	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160965265	missense	probably benign
R5697:Chd6	UTSW	2	161018051	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160949878	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160983762	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160957078	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160957079	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160965827	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160965582	missense	probably benign
R6104:Chd6	UTSW	2	161014132	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160950048	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160979487	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160965498	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	161013067	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160966254	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160960359	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160965730	missense	probably benign
R6895:Chd6	UTSW	2	160988340	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	161013127	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	161025965	nonsense	probably null
R7064:Chd6	UTSW	2	160950063	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160961279	nonsense	probably null
R7287:Chd6	UTSW	2	161008392	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161026328	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160950003	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	161013154	missense	probably damaging	1.00
R7699:Chd6	UTSW	2	161025943	missense	probably benign	0.13
R7748:Chd6	UTSW	2	160966619	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160970175	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8261:Chd6	UTSW	2	160957082	missense	probably damaging	1.00
R8317:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8388:Chd6	UTSW	2	161019651	missense	probably damaging	1.00
R8867:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8996:Chd6	UTSW	2	160981623	missense	probably damaging	1.00
R9091:Chd6	UTSW	2	161029873	nonsense	probably null
R9270:Chd6	UTSW	2	161029873	nonsense	probably null
R9310:Chd6	UTSW	2	161039261	missense	probably damaging	1.00
R9367:Chd6	UTSW	2	161029864	missense	possibly damaging	0.83
R9438:Chd6	UTSW	2	160957158	missense	probably benign	0.01
R9756:Chd6	UTSW	2	160960339	missense	probably benign
Z1088:Chd6	UTSW	2	160966488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTACCTCAGGTCAAGGCAAC -3'
(R):5'- CTAAGGGTGTTCAATGCCCCAG -3'

Sequencing Primer
(F):5'- CAAAGGCAGCTGCAGTGTGTG -3'
(R):5'- TTCAATGCCCCAGTGTAGG -3'

Posted On

2021-07-15