Incidental Mutation 'R8865:Rfc1'
ID 675857
Institutional Source Beutler Lab
Gene Symbol Rfc1
Ensembl Gene ENSMUSG00000029191
Gene Name replication factor C (activator 1) 1
Synonyms 140kDa, Recc1, Alp145, RFC140
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8865 (G1)
Quality Score 148.008
Status Validated
Chromosome 5
Chromosomal Location 65261850-65335670 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 65278792 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 636 (D636E)
Ref Sequence ENSEMBL: ENSMUSP00000145385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172732] [ENSMUST00000203471] [ENSMUST00000203581] [ENSMUST00000204965]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000172732
AA Change: D622E

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134444
Gene: ENSMUSG00000029191
AA Change: D622E

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 627 762 9.65e-10 SMART
Pfam:RFC1 899 1052 5.2e-62 PFAM
low complexity region 1104 1132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203471
AA Change: D623E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144954
Gene: ENSMUSG00000029191
AA Change: D623E

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 627 762 9.65e-10 SMART
Pfam:RFC1 899 1052 2.5e-61 PFAM
low complexity region 1104 1132 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203581
AA Change: D636E

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145385
Gene: ENSMUSG00000029191
AA Change: D636E

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 322 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
BRCT 415 493 7.39e-17 SMART
low complexity region 498 516 N/A INTRINSIC
AAA 640 775 9.65e-10 SMART
Pfam:RFC1 912 1065 2.6e-61 PFAM
low complexity region 1117 1145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204965
AA Change: D623E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144980
Gene: ENSMUSG00000029191
AA Change: D623E

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 627 762 9.65e-10 SMART
Pfam:RFC1 899 1052 2.5e-61 PFAM
low complexity region 1104 1131 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large subunit of replication factor C, a five subunit DNA polymerase accessory protein, which is a DNA-dependent ATPase required for eukaryotic DNA replication and repair. The large subunit acts as an activator of DNA polymerases, binds to the 3' end of primers, and promotes coordinated synthesis of both strands. It may also have a role in telomere stability. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T A 11: 50,781,744 Y606* probably null Het
Adgrb1 A G 15: 74,543,658 I696V possibly damaging Het
Ass1 A G 2: 31,520,395 Q406R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccdc148 T C 2: 58,829,820 K409R possibly damaging Het
Ccnl1 A T 3: 65,946,848 S451T probably benign Het
Cdc123 T C 2: 5,795,424 probably benign Het
Cep192 T C 18: 67,834,632 V729A probably benign Het
Chd6 G A 2: 161,021,069 A444V probably benign Het
Chl1 A G 6: 103,708,861 K898E probably damaging Het
Chrng T C 1: 87,207,497 V154A probably damaging Het
Cog1 T G 11: 113,658,498 M799R probably benign Het
Col4a3 G A 1: 82,669,762 probably null Het
Coro6 C A 11: 77,469,091 T366K probably damaging Het
Cwh43 G A 5: 73,441,359 M640I probably benign Het
Cyp2c55 A G 19: 39,031,434 E272G probably benign Het
Cyp4f39 A G 17: 32,483,297 Y256C probably damaging Het
Dbx2 G A 15: 95,632,400 R229* probably null Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
En1 G T 1: 120,603,000 probably benign Het
F3 T A 3: 121,729,411 V90E probably damaging Het
Fam171a1 A G 2: 3,225,903 K691R probably damaging Het
Foxp2 C T 6: 15,415,094 A609V unknown Het
Hemgn A T 4: 46,396,682 S185T possibly damaging Het
Hk1 C T 10: 62,315,515 D33N probably benign Het
Igfbp1 T A 11: 7,201,929 V244D probably damaging Het
Insr A T 8: 3,161,358 D1160E probably damaging Het
Irs1 A T 1: 82,288,109 Y795* probably null Het
Krtap28-10 T C 1: 83,042,087 K111E unknown Het
Lbx1 T G 19: 45,235,166 D21A probably benign Het
Map6 G T 7: 99,268,985 A322S probably benign Het
Mat1a T C 14: 41,121,831 Y336H probably damaging Het
Mcf2l A G 8: 12,880,003 I8V probably benign Het
Med12l T C 3: 59,071,882 V276A probably benign Het
Mettl17 A G 14: 51,884,851 probably benign Het
Mllt1 T C 17: 56,900,295 D183G possibly damaging Het
Msmb T A 14: 32,150,260 C69* probably null Het
Mterf1a A G 5: 3,891,425 S148P probably damaging Het
Mybl2 A G 2: 163,080,733 I583V probably benign Het
Nbr1 T A 11: 101,564,694 D91E probably benign Het
Notch3 A G 17: 32,122,116 Y2221H probably benign Het
Npat C A 9: 53,570,640 T1216N probably benign Het
Olfr1082 C A 2: 86,594,400 V143F possibly damaging Het
Olfr127 T C 17: 37,904,224 L226P probably damaging Het
Olfr137 T A 17: 38,304,981 H160L probably damaging Het
Pawr T A 10: 108,382,742 Y170N probably damaging Het
Pde12 T C 14: 26,669,125 D143G possibly damaging Het
Phactr2 A G 10: 13,253,732 I264T probably benign Het
Pip5k1b A G 19: 24,397,058 L53P probably damaging Het
Pknox1 T C 17: 31,599,546 I251T probably benign Het
Plcxd1 A T 5: 110,101,975 probably benign Het
Polr3c C T 3: 96,715,201 probably benign Het
Ppil2 T C 16: 17,097,405 N113S probably benign Het
Pramel4 G C 4: 144,068,482 G483R probably damaging Het
Prdm10 T C 9: 31,327,397 L195P probably damaging Het
Prss16 A T 13: 22,003,005 L465Q possibly damaging Het
Psg25 G T 7: 18,529,594 H101Q possibly damaging Het
Pstpip2 A G 18: 77,846,408 D55G possibly damaging Het
Scarf2 G T 16: 17,803,110 C214F probably damaging Het
Sirt4 T C 5: 115,482,645 E156G probably damaging Het
Spag6 C T 2: 18,734,117 S286L probably benign Het
Stx17 T A 4: 48,183,444 H267Q unknown Het
Tekt3 T C 11: 63,070,232 C76R probably benign Het
Tln1 A T 4: 43,538,281 V1807E possibly damaging Het
Tnfrsf21 A G 17: 43,085,481 D552G probably damaging Het
Ttn C A 2: 76,730,320 V29246L possibly damaging Het
Usp43 C A 11: 67,898,962 C252F probably damaging Het
Vmn2r16 T C 5: 109,340,044 I261T probably benign Het
Vwa5b1 T C 4: 138,581,219 E769G probably benign Het
Xrn1 T A 9: 95,991,193 F670Y probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zdhhc14 A T 17: 5,725,295 Y274F possibly damaging Het
Zeb2 T A 2: 44,996,127 M973L probably benign Het
Zfp638 T C 6: 83,977,053 V1380A possibly damaging Het
Other mutations in Rfc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Rfc1 APN 5 65296009 missense probably benign 0.00
IGL00909:Rfc1 APN 5 65279699 missense probably benign 0.00
IGL01791:Rfc1 APN 5 65263145 missense probably benign 0.00
IGL01884:Rfc1 APN 5 65274460 missense possibly damaging 0.94
IGL02737:Rfc1 APN 5 65311163 missense possibly damaging 0.82
Disturbing UTSW 5 65266162 missense probably damaging 1.00
P0038:Rfc1 UTSW 5 65287961 missense probably damaging 1.00
R0317:Rfc1 UTSW 5 65296052 splice site probably null
R0452:Rfc1 UTSW 5 65264297 missense probably benign 0.01
R0699:Rfc1 UTSW 5 65319399 splice site probably null
R0945:Rfc1 UTSW 5 65278709 critical splice donor site probably null
R1192:Rfc1 UTSW 5 65293911 missense probably benign 0.03
R1341:Rfc1 UTSW 5 65291194 missense probably damaging 1.00
R1425:Rfc1 UTSW 5 65319518 missense probably damaging 1.00
R1551:Rfc1 UTSW 5 65277363 missense probably damaging 0.99
R1800:Rfc1 UTSW 5 65264379 missense probably damaging 1.00
R1969:Rfc1 UTSW 5 65319524 missense probably damaging 1.00
R2006:Rfc1 UTSW 5 65311054 nonsense probably null
R2026:Rfc1 UTSW 5 65288029 missense probably damaging 1.00
R2073:Rfc1 UTSW 5 65301939 missense probably damaging 0.98
R2137:Rfc1 UTSW 5 65311039 critical splice donor site probably null
R2330:Rfc1 UTSW 5 65312969 missense possibly damaging 0.94
R3774:Rfc1 UTSW 5 65264406 missense probably damaging 1.00
R3787:Rfc1 UTSW 5 65296014 missense probably benign 0.00
R4920:Rfc1 UTSW 5 65287928 missense probably damaging 1.00
R5055:Rfc1 UTSW 5 65266162 missense probably damaging 1.00
R5308:Rfc1 UTSW 5 65279461 missense probably damaging 0.99
R5723:Rfc1 UTSW 5 65277426 missense probably null 0.78
R5729:Rfc1 UTSW 5 65277452 missense probably damaging 1.00
R5844:Rfc1 UTSW 5 65293787 missense probably benign 0.19
R6045:Rfc1 UTSW 5 65279549 missense probably damaging 1.00
R6484:Rfc1 UTSW 5 65293677 missense probably benign 0.01
R6495:Rfc1 UTSW 5 65273815 splice site probably null
R6531:Rfc1 UTSW 5 65312979 missense possibly damaging 0.92
R6717:Rfc1 UTSW 5 65302004 nonsense probably null
R6717:Rfc1 UTSW 5 65312961 missense probably damaging 0.97
R6845:Rfc1 UTSW 5 65311116 missense possibly damaging 0.53
R6880:Rfc1 UTSW 5 65277386 missense probably benign 0.14
R7329:Rfc1 UTSW 5 65263135 missense unknown
R7331:Rfc1 UTSW 5 65311044 missense probably damaging 1.00
R7466:Rfc1 UTSW 5 65275426 missense probably damaging 1.00
R7497:Rfc1 UTSW 5 65279498 missense probably damaging 1.00
R7588:Rfc1 UTSW 5 65272507 missense probably damaging 1.00
R8020:Rfc1 UTSW 5 65272178 missense probably damaging 1.00
R8056:Rfc1 UTSW 5 65294093 intron probably benign
R8282:Rfc1 UTSW 5 65268946 critical splice donor site probably null
R8316:Rfc1 UTSW 5 65278734 missense probably benign 0.05
R8320:Rfc1 UTSW 5 65303036 nonsense probably null
R8968:Rfc1 UTSW 5 65275435 missense probably benign 0.03
R8997:Rfc1 UTSW 5 65275721 missense probably damaging 1.00
R9454:Rfc1 UTSW 5 65274431 missense
R9476:Rfc1 UTSW 5 65279799 missense probably damaging 0.99
R9631:Rfc1 UTSW 5 65272508 missense probably damaging 1.00
R9758:Rfc1 UTSW 5 65302048 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTCAATAACAGGTTTAAGGTGGGG -3'
(R):5'- AAGCTGAGGTAAGCACTGGC -3'

Sequencing Primer
(F):5'- AGGCTGGCCTTGAATTAACC -3'
(R):5'- AGTGACCTACAGCCTCATTACATTG -3'
Posted On 2021-07-15